Перевести страницу

Классическая волновая физика радиоэфира Фарадея-Максвелла

Рубиновая энергетика и эфироопорные двигатели

Пикотехнология белков

Биотехнология вечной молодости

Исследования мегалитов

Инопланетная инженерия




Расширенная программируемая архитектура белков

Проект Пикотехнология Белков Онлайн

                                                                                                  

Пикотехнология белков, ДНК, РНК. Часть 1

Пикотехнология белков, ДНК, РНК. Часть 2   

Пикотехнология белков, ДНК, РНК. Часть  3



Формы, механизмы, энергия наномира. Сообщение 87 365

Пикотехнология белков, ДНК, РНК - 3

Татьяна Рясина пишет:

поменять углы поворотов

Кушелев: Композиционные углы не менять надо, а настроить один раз. Дальше они уже будет слегка меняться с учётом физико-химических взаимодействий. И продавать нужно не программу, а конкретные структуры белков. Продажа прогрммы может привести к дискредитации научного направления, т.к. пользователи будут использовать её некорректно и получать неправильные результаты. Яркий пример - некто Leo, который взялся проводить экспертизу одной из первых версий программы Пикотех. Для начала он её изуродовал, т.е. упростил до такой степени, что она практически перестала работать. После этого раскритиковал. Чтобы этого безобразия не повторялось в будущем, нужно не программу продавать, а заказы на структуры белков выполнять. Онлайн-сервис - это тоже заказы. Но на уровне Пикотех-2D они могут выполняться автоматически. На уровне 3D пока лишь с ручной доработкой.

https://img-fotki.yandex.ru/get/215803/158289418.40d/0_178d08_42496493_orig.png



Татьяна Рясина пишет:

(Кстати, а можно сделать программу, которая виртуально кристаллизует белок и показывает рентгенграмму ?????  ))))))  Т.е. сделать симулятор РСА )))))

Можно, можно. И скатерть-самобранку можно. Ищите инвестора smile



Формы, механизмы, энергия наномира. Сообщение 87 374

Пикотехнология белков, ДНК, РНК - 3

krooto пишет: 

АЮ, то есть ваш алгоритм показывает только самую базовую структуру белка ?
А как он свернется дальше может уже показать только РСА ?

Kushelev пишет:

А чем Вас не устроили 6 участков разных лизоцимов, которые замкнулись через дисульфидные мостики?

Композиционный код и формы аминокислот могут показать геометрическую модель белка, который построен рибосомой. Естественно, что в процессе построения белка он деформируется за счёт взаимодействия элементарных частиц между собой. Без учёта этого взаимодействия модель не может иметь пикотехнологическую точность в дальней зоне. Но в ближней зоне точность в большинстве случаев получается. Вы же знаете, что параметры альфа-спирали известны с высокой точностью, т.к. это - периодическая структура. Большинство белковых молекул содержат протяженные участки альфа-спиралей. Эти зоны программа "Пикотех-3D" показывает идеально. Правда, в том случае, если после сборки рибосомой молекула белка не модифицировалась. Модифицированные молекулы нужно естественно моделировать с учётом этой модификации.

Что касается рентгена (РСА), то он часто не помогает определить даже тип белка, т.е. что преобладает в его структуре, альфа-310-спирали или пи-бета-спирали. Поэтому программа Пикотех даже на уровне вторичной структуры даёт на порядок более ценную информацию, что РСА. Естественно разные методы дополняют друг друга.

https://img-fotki.yandex.ru/get/244791/158289418.404/0_1786ae_a2c56a57_orig.png
Если Вы знаете, что от и до идёт альфа-спираль, то РСА Вам уже в этом вопросе не даст даже 1% полезной информации.

https://img-fotki.yandex.ru/get/205820/158289418.404/0_1786aa_d8df5a21_orig.png
РСА не может с такой точностью определять вторичную структуру. Естественно, что третичную структуру РСА определяет условно. Сами подумайте, если вместо пи-спирали он показывает альфа или вообще "нет структуры", то о какой 3D-точности может идти речь? smile



https://www.ncbi.nlm.nih.gov/protein/74 … SDMTTNU015

https://www.ncbi.nlm.nih.gov/nuccore/743960172

>ENA|BAQ14176|complement 2013 nucleotides
gtggtaaagataacatatccgttattttgtttgaaggagagtgtgaatatgataggaacc
aaattaggtaataggtatgaacttcttgaaaaagttggagagggtggtatggctacagtt
tataaagctaaatgccattacctaaatagatttgtcgcaataaagatattaaaagagcaa
ttttgcagtgacaaagaatttgtagaaaaatttaaaagagaagcaacttcagtagcgagc
ttatcagataacaatatagtaaatatttatgatgtaggttctgaaaataatatacattat
atagttatggaatatgtagatggtaaaactttaaaggaattaatagtagaaaaagggaaa
attgatcctaaggaaactgttagaatatcaaaacaaatagctagtgctttggtttgtgct
catagaaacaatattatacatagagatataaaaccacacaatatattagttacaaaagaa
ggaattgttaaggttacagattttggtatagcaaaggcttcaaattcagctactataaca
aattctagtaaagtaatgggatcagctcattatttttcaccagaacaagctaaaggaagt
tttgtggactcaagaactgatatatattctttaggtatagtaatgtatgaaatgcttgtg
ggaaaagttccattcgatggagagagccctgtatctgtagcagtaaagcatatacaaaat
gaagtagtagcaccaaaagaaatagatgataaaattccagaaagtttaaatagtttagta
ctaaagtgcttggaaaaaaatcctgtaaaaagatatcaaactataaaaaatttagaagag
gacttagctagaatagaaaataatgaaaatatattaaatggatctagcaatatatcagaa
aacgatgttactagagtaatggacacagcggttataaatgacaaaataaaagaaatggct
caaaatggtgagtatgaagatgatgatgaggaatatgaagatgatgatgaggaatatgaa
gatgaagaggatgaaatagaggataaaaagaaaagaagtaataagggtaaaacaaataaa
aaattaatattaggaatagctatggcagttttatttctagttgtaggatctgtatctgca
tacttggccttcaataaatcaggagggaaaaaggtagaagttcctaatgtagtaggactt
actaaagaagaagcggaaaaggtattaagtgagaaaaaattaaaattagtagtagctcaa
aaggttaaaaatgaaaaaaaggaaggaactataatagaatcttatccaaaatccggtgaa
aaagtagcagaaaattccgaagtaagagttagtataagttctgggaatgtagtagttgtg
cctaatttaaagggaatggaattagaggccgctaaaaaagcaatacaagatcttaaatta
aaagtagggaatgtaaaatatgaatttaatgacaatgtagcttctggaaaagtaataagt
caaactccagatatagatgcagaattaaaagaaggagaagaaattagtttagttataagc
aatggtccagaaattaaatactcaacagtacctaacttaataggaaaatctatagatgga
gctcaaaatgctttagctaatgcaggactatctatgggaggctcaaaggctattattaca
gaagatcaatccttagatggccaagtggcatcacaaagcataggtgcaggacaaagcata
aaacaaggttcttccgtaagtatatcctattataaatacaaaaaaccagaaccaaaacca
gacccaaaaccagatacagatacaggtaaggatccaggaacagacacaggtaagaatcca
ggaacagacacaggtaaggacccaggaacagatacaggcaaggatccaggaacagataca
ggtaaggatccaggaacagatccaggaacagatacaggcaaggatccaggaacagacaca
ggtaaggattcaggaactactcctaaaaaataa

https://img-fotki.yandex.ru/get/218038/158289418.408/0_1789ea_a6723a52_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/117896/ … 6_orig.png

Фрагмент:

https://img-fotki.yandex.ru/get/235015/158289418.408/0_1789ec_3ca8357b_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/195125/ … 9_orig.png

https://img-fotki.yandex.ru/get/198613/158289418.408/0_1789ed_bab1c6f4_orig.png

https://img-fotki.yandex.ru/get/114207/158289418.408/0_1789ee_7b85f5c2_orig.png

Изменение бета- и пи- композиционных углов существенно изменило форму модели фрагмента белка.



https://www.ncbi.nlm.nih.gov/protein/11 … SDMTTNU015

https://www.ncbi.nlm.nih.gov/nuccore/1145424954

>ENA|SJN11245|4035 nucleotides

https://img-fotki.yandex.ru/get/102548/158289418.408/0_1789f3_66042d1b_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.408/0_1789f4_bb72d67a_orig.png



Пикотехнология белков, ДНК, РНК - 3

https://www.ncbi.nlm.nih.gov/protein/10 … W6YTK2A01R

https://www.ncbi.nlm.nih.gov/nuccore/1036951433

>ENA|XP_017074914|4821 nucleotides

3D-модели пока годятся для топологического, но не для параметрического анализа. Ждём интерактивную версию программы Пикотех для точной настройки композиционных углов. Хотя и это - не панацея, т.к. у большинства аминокислотных остатков есть два изменяемых угла. Композиционный и транспозиционный. Причём транспозиционный меняется на десятки градусов в зависимости от физико-химических условий. А у пролина есть третий изменяемый угол. Есть ещё метионин, который гнёт альфа-310-спирали. Так что работы по совершенствованию программы Пикотех хватит на много версий smile

Но программой Пикотех 2D можно пользоваться уже сегодня, т.к. она даёт исключительно надёжные результаты и богатейшую информацию для анализа. Вместе с данными РСА программа Пикотех 2D может увеличить эффективность анализа белковых структур на несколько порядков. А для белков, которые не кристаллизуются (их 97%) только программа Пикотех 2D может дать важнейшую информацию о структуре.

https://img-fotki.yandex.ru/get/222565/158289418.40b/0_178b58_af6f5f59_orig.png

https://img-fotki.yandex.ru/get/222565/158289418.40c/0_178b59_4c15d005_orig.png

https://img-fotki.yandex.ru/get/176331/158289418.40c/0_178b5a_eeff637d_orig.png


https://img-fotki.yandex.ru/get/30602/158289418.40c/0_178b5d_634f26ee_orig.png

https://img-fotki.yandex.ru/get/172272/158289418.40c/0_178b5e_99545428_orig.png

https://img-fotki.yandex.ru/get/106972/158289418.40c/0_178b5f_7867abe1_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 357

Пикотехнология белков, ДНК, РНК - 3

http://humbio.ru/humbio/molevol/000199bc.htm

Цитата: По взаимной ориентации в структуре ДНК различаются прямые, инвертированные, симметричные повторы, палиндромы, комплементарные палиндромы и т.п.
Конец цитаты.

Кушелев: Оказывается на уровне нуклеотидных последовательностей это уже широко известно...



http://humbio.ru/humbio/molevol/000199bc.htm

Цитата: периодичность повторений ДНК может иметь очень сложную структуру, когда короткие повторы включены в более протяженные или окаймляют их и т.д.

Кушелев: Оказывается на уровне нуклеотидных последовательностей это уже широко известно...


Кушелев: А вот и одна из онлайн-систем для поиска повторяющихся нуклеотидных последовательностей: http://bioinfo.lifl.fr/mreps/mreps.php


Формы, механизмы, энергия наномира. Сообщение 87 360

Пикотехнология белков, ДНК, РНК - 3

Skype, 2017-04-27:

Кушелев Золдраксу: Существует ли сервис, который ищет в геноме или в большом файле типа fasta повторяющиеся куски нуклеотидной последовательности? Последовательность заранее неизвестна. Известно только, что 3...99 нуклеотидов должны 3...30 раз повториться подряд.
Такие повторы соответствуют программным спиралям белка: http://nanoworld.org.ru/post/87005/#p87005

[9:18:21] Zoldrax: Так сразу не скажу. Есть много программ для поиска геномных повторов. Какая подойдет надо разбираться. Первое что нагуглилось https://tandem.bu.edu/trf/trf.html
[9:22:16] Zoldrax: Чтобы искать не по геному целиком, нужно вместо генома в программу подавать CCDS.
[11:09:58] Кушелев Александр Юрьевич: ЗдОрово! Спасибо!



Формы, механизмы, энергия наномира. Сообщение 87 322

Пикотехнология белков, ДНК, РНК - 3

Гиперзвуковые глиссады белковых конвейеров

Последовательность аминокислот создают в ближней зоне белковой молекулы гиперзвуковую глиссаду для реагентов.

Я пришёл к этому выводу в результате следующих рассуждений. Хаотическое движение молекул воды возбуждает радикалы аминокислот, которые начинают "звенеть", подобно камертону при воздействии на него белым шумом.

Гиперакустическое поле приводит к эффекту акустической нано-левитации, т.е. захвату молекул, настроенных на данную частоту и удержание в глиссаде.

Изменение гиперакустического поля по программе (по нотам) приводит к программированию многостадийных био-химических реакций. Молекулы реагенты перемещаются по гиперакустической глиссаде, которая имеет вид разветвлённой конвейерной сети. В процессе перемещения по конвейеру химические соединения претерпевают запрограммированные превращения.

Высота нот (частота звучания) радикалов аминокислотных остатков направляет химические соединения вдоль глиссады. Многозвучия ориентируют и сдвигают химические соединения до расстояний их взаимодействия и превращения в продукты реакций.

https://img-fotki.yandex.ru/get/228174/158289418.409/0_178a47_927b6cb7_orig.png

Симметричные реакторы позволяют создавать многопоточные биохимические реакции повышенной надёжности и производительности.



Формы, механизмы, энергия наномира. Сообщение 87 317

Пикотехнология белков, ДНК, РНК - 3

Невозможная музыка белков

Письмо Дидье Маруани / Didier Marouani от Кушелева

Dear Didier!
Can you write music based on the unusual music of building a protein molecule? The musical size is 7/8. See the attached files.

Warm wishes,
Your Alexander Kushelev

Russian original:

Дорогой Дидье!
Можешь ли ты написать музыку на основе необычной музыки сборки белковой молекулы? Музыкальный размер 7/8. Смотри вложенные файлы.

midi: https://cloud.mail.ru/public/AJFi/4d2BwBDCW

https://img-fotki.yandex.ru/get/57985/158289418.409/0_1789fc_d7afb38c_orig.png

https://img-fotki.yandex.ru/get/194869/158289418.408/0_1789f6_fceef9ba_orig.png

https://img-fotki.yandex.ru/get/52325/158289418.408/0_1789f7_e8431976_orig.png



Формы, механизмы, энергия наномира. Сообщение 87 318

Пикотехнология белков, ДНК, РНК - 3

Ищем музыку Кушелева с музыкальным размером 7/8 в базе нуклеотидных последовательностей.




https://www.ncbi.nlm.nih.gov/nucleotide … TZNP3C8014

KU725248

>ENA|KU725248|511 nucleotides


https://img-fotki.yandex.ru/get/98619/158289418.409/0_178a03_2e43facb_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/172684/ … 9_orig.png

Здесь мы не видим искомой последовательности нот. Что это значит? Это значит, что данный белок построен со сдвигом рамки считывания на 1 или 2 позиции. В этом случае можно сказать, что музыка спрятана, но достаточно сдвинуть рамку считывания, и она проявится.

https://img-fotki.yandex.ru/get/236311/158289418.409/0_178a04_af05c877_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.409/0_178a05_13489adb_orig.png

Изменение углов бета- и пи-спиралей на 30 градусов существенно меняет форму модели белка. К сожалению, уточнить форму моделей мы сможем только после создания интерактивной верстии программы Пикотех-3D.



Пикотехнология белков, ДНК, РНК - 3

Ищем 5*ghphpti

https://blast.ncbi.nlm.nih.gov

https://www.ncbi.nlm.nih.gov/protein/10 … U56KV12014

https://www.ncbi.nlm.nih.gov/nuccore/1084799531

http://molbiol.ru/scripts/01_12.html

>ENA|OGQ36638|complement 1398 nucleotides
atgaagttcagactttttctaatctttttaccgcttattaccatttgttcccttgcagaa
gctggtgatttaaagattgaaaagaggatcgccggggaaaatctctcccttgttttgtct
gaaggggagaaaatttatgagctctacacctttatccccgattcagcgcgggatccattc
gcgcagggaacccctctctttctcggggttattgagagaagcggtgataaacaaagggtg
atctattttcataatgccacggactcctttccagctgatctcaggattgtagatgggaaa
attttcgtcctgctacaggactacaatgggaagggcggtaagattatcgagccggtttcc
ggcagtgagatttattcgggattaatagggagaggtctatgggatatgctagataatacg
ccgaccattcgtcatcctgagccgaccattcgtcatcctgagccgaccattcgtcatcct
gagccgaccattcgtcatcctgagccgaaggcgaaggatctcaacacgcgagattgcttc
gcttcgctcgcaatgacgaatacgatcgcaatgtactatgtttcatctggtgagttattc
gaggttttaaatggagaaaaaagaagattagctgatttaaatccctataatagaatagaa
aagatttccgtaaataaagatgggatttatatctcatgtgatgaggggctgcttctttac
gattttttacgtgcggggctgataaaaataacaaacgaatcaccaccttggtttaaagca
gaagcaaatggcggggttttatatcttgagacaaatgagatcagaagatggtccaatacg
gaagatgcaaagagttattacaagtcggattccgagatatggtttataaagaagaatacc
gattcacttttggttatcgatgataaaataacaattatttcaaatggagagcctaattct
attgaggtgggagaggaggattcctttgcaaacctgagagacgcggttttttcagcaggt
tcaattattatttattacagcgatacgatttccaggattattcgcggcattaaaagacgc
atcaggttgcatccgaatgatggtgacagggatttattggcgcagctcctcaaagaccag
aaaattgacgctgacgtaatattctcgattgtgcgggaggatctgaatgcgtcttccaac
aatgaagagattatcaggaacaaactctttgccctctcgctcctcgaattattaggagaa
gagggatttgaggagggtaagcgtatttatttggaatgggctcactcaatttcggaaagc
atagagaagatttttatcgaaaaactgaaaaagatcgatccccaaaaaaccaacgaacta
cttattaagaaatattaa

https://img-fotki.yandex.ru/get/197852/158289418.409/0_178a07_664ec1f4_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/215222/ … b_orig.png

В этом белке музыка Кушелева тоже спрятана, но ...

Фрагмент:

https://img-fotki.yandex.ru/get/196102/158289418.409/0_178a0a_788c7eb_orig.png
Сдвиг рамки считывания привёл к изменению нот, но не музыкального размера!

https://img-fotki.yandex.ru/get/223280/158289418.409/0_178a0e_351b8b01_orig.png

https://img-fotki.yandex.ru/get/218038/158289418.409/0_178a09_1bbefd85_orig.png

https://img-fotki.yandex.ru/get/194550/158289418.409/0_178a30_eb33496_orig.png
Музыка в стандарте MIDI: https://cloud.mail.ru/public/ET8V/ZXmt9rGVo

Мы можем послушать другую музыку с размером 7/8. При этом мы сможем услышать и две спрятанных мелодии с размером 7/8. Одна из них - 4 такта музыки Кушелева.

https://img-fotki.yandex.ru/get/194550/158289418.409/0_178a0b_ce5edd65_orig.png

https://img-fotki.yandex.ru/get/233608/158289418.409/0_178a0c_2ee076b5_orig.png

https://img-fotki.yandex.ru/get/196258/158289418.409/0_178a0d_db175d15_orig.png

https://img-fotki.yandex.ru/get/215222/158289418.409/0_178a0f_edfb70c2_orig.png

Изменим бета- и пи- композиционные углы

https://img-fotki.yandex.ru/get/93949/158289418.409/0_178a10_2de0f745_orig.png

https://img-fotki.yandex.ru/get/57985/158289418.409/0_178a11_86229d94_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.409/0_178a12_3a3209b1_orig.png

https://img-fotki.yandex.ru/get/219501/158289418.409/0_178a13_34d0dfcd_orig.png

Полный комплект файлов: https://cloud.mail.ru/public/AUWB/urtpXx4pY

В будущем можно будет уточнить форму 3D-моделей.

Удлиним фрагмент:

https://img-fotki.yandex.ru/get/196102/158289418.409/0_178a32_faabb09c_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/196102/ … 7_orig.png

https://img-fotki.yandex.ru/get/95493/158289418.409/0_178a33_302a9b9d_orig.png

https://img-fotki.yandex.ru/get/194588/158289418.409/0_178a34_87454028_orig.png

https://img-fotki.yandex.ru/get/95493/158289418.409/0_178a35_d67a1a77_orig.png

https://img-fotki.yandex.ru/get/103691/158289418.409/0_178a36_f56adba1_orig.png

https://img-fotki.yandex.ru/get/102548/158289418.409/0_178a44_809a0fa4_orig.png

https://img-fotki.yandex.ru/get/236239/158289418.409/0_178a45_b01f99f7_orig.png

https://img-fotki.yandex.ru/get/236239/158289418.409/0_178a46_e1009254_orig.png

https://img-fotki.yandex.ru/get/228174/158289418.409/0_178a47_927b6cb7_orig.png

https://img-fotki.yandex.ru/get/228174/158289418.409/0_178a48_6b6519f5_orig.png

Изменим композиционные углы бета- и пи-

https://img-fotki.yandex.ru/get/195431/158289418.409/0_178a49_843bba8d_orig.png

https://img-fotki.yandex.ru/get/218579/158289418.409/0_178a4a_37ac6ef8_orig.png

https://img-fotki.yandex.ru/get/228104/158289418.409/0_178a4b_251d4c99_orig.png

https://img-fotki.yandex.ru/get/196600/158289418.40a/0_178a4c_171e560f_orig.png

https://img-fotki.yandex.ru/get/218579/158289418.40a/0_178a4d_12093ac4_orig.png

https://img-fotki.yandex.ru/get/194549/158289418.40a/0_178a4e_e225b176_orig.png

https://img-fotki.yandex.ru/get/196600/158289418.40a/0_178a4f_a270bba9_orig.png

https://img-fotki.yandex.ru/get/94596/158289418.40a/0_178a50_21ae832_orig.png

В мире белковых молекул композиционные углы сильно не меняются, но для программированной архитектуры можно сделать элементы с разными композиционными углами. В этом случае по одной и той же программе будут строиться конструкции разной формы. Это так называемая "расширенная программируемая архитектура"...




Формы, механизмы, энергия наномира. Сообщение 87 324

Пикотехнология белков, ДНК, РНК - 3

Невозможная музыка белков

https://img-fotki.yandex.ru/get/195648/158289418.40a/0_178a87_976395a5_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/196258/ … 7_orig.png

https://img-fotki.yandex.ru/get/195648/158289418.40a/0_178a88_382ba719_orig.png

https://img-fotki.yandex.ru/get/114207/158289418.40a/0_178a89_8565edd2_orig.png

https://img-fotki.yandex.ru/get/194778/158289418.40a/0_178a8a_b982fa8a_orig.png

https://img-fotki.yandex.ru/get/194588/158289418.40a/0_178a8b_6ddc5994_orig.png

https://img-fotki.yandex.ru/get/242441/158289418.40a/0_178a8c_142492c2_orig.png

***
https://img-fotki.yandex.ru/get/196600/158289418.40a/0_178a8f_728f2aa8_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/104595/ … f_orig.png

https://img-fotki.yandex.ru/get/223280/158289418.40a/0_178a90_96b21551_orig.png

https://img-fotki.yandex.ru/get/52446/158289418.40a/0_178a91_6b9ab686_orig.png

https://img-fotki.yandex.ru/get/174613/158289418.40a/0_178a92_5515b54_orig.png

***
https://img-fotki.yandex.ru/get/196258/158289418.40a/0_178a9a_e01f0eeb_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/94596/1 … 4_orig.png

https://img-fotki.yandex.ru/get/169883/158289418.40a/0_178a9b_9b33950a_orig.png

https://img-fotki.yandex.ru/get/239438/158289418.40a/0_178a9c_20cf4ea3_orig.png

https://img-fotki.yandex.ru/get/226123/158289418.40a/0_178a9d_b5aceb39_orig.png

https://img-fotki.yandex.ru/get/104083/158289418.40a/0_178a9e_a5cba605_orig.png

https://img-fotki.yandex.ru/get/239438/158289418.40a/0_178a9f_290ce695_orig.png

https://img-fotki.yandex.ru/get/227342/158289418.40a/0_178aa0_7c9888d5_orig.png

https://img-fotki.yandex.ru/get/197807/158289418.40a/0_178aa1_74ddaea7_orig.png

https://img-fotki.yandex.ru/get/98619/158289418.40a/0_178aa2_34e5bf23_orig.png

***
https://img-fotki.yandex.ru/get/225650/158289418.40a/0_178aa4_e3e48874_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/62142/1 … 6_orig.png

https://img-fotki.yandex.ru/get/197807/158289418.40a/0_178aa5_cdbe17d1_orig.png

https://img-fotki.yandex.ru/get/194858/158289418.40a/0_178aa6_3e55e19c_orig.png

https://img-fotki.yandex.ru/get/225650/158289418.40a/0_178aa7_ca8b6623_orig.png

https://img-fotki.yandex.ru/get/177902/158289418.40a/0_178aa8_a112745c_orig.png

***
https://img-fotki.yandex.ru/get/102548/158289418.40a/0_178aaa_c08c2c02_orig.png

Развёрнуто: https://img-fotki.yandex.ru/get/196486/ … 7_orig.png

https://img-fotki.yandex.ru/get/125649/158289418.40a/0_178aab_497914ba_orig.png

https://img-fotki.yandex.ru/get/168237/158289418.40a/0_178aac_78c8571_orig.png

https://img-fotki.yandex.ru/get/194835/158289418.40a/0_178aad_3d4332df_orig.png

https://img-fotki.yandex.ru/get/177849/158289418.40a/0_178aae_c87e38bc_orig.png

https://img-fotki.yandex.ru/get/196258/158289418.40a/0_178aaf_ee02f2d8_orig.png

https://img-fotki.yandex.ru/get/226123/158289418.40a/0_178ab0_fc8e4ead_orig.png

https://img-fotki.yandex.ru/get/94189/158289418.40a/0_178ab1_e2f07b5e_orig.png

https://img-fotki.yandex.ru/get/103922/158289418.40a/0_178ab2_d6abe6fb_orig.png

https://img-fotki.yandex.ru/get/196121/158289418.40a/0_178ab3_79821d31_orig.png

https://img-fotki.yandex.ru/get/226123/158289418.40a/0_178ab4_f0c97eba_orig.png

https://img-fotki.yandex.ru/get/62142/158289418.40a/0_178ab5_77ee084d_orig.png

https://img-fotki.yandex.ru/get/196060/158289418.40a/0_178ab6_a0edbe40_orig.png


Полный комплект файлов: https://cloud.mail.ru/public/AUWB/urtpXx4pY



Формы, механизмы, энергия наномира. Сообщение 87 569

Письмо Дидье Маруани / Didier Marouani от Кушелева

Невозможная музыка белков

https://img-fotki.yandex.ru/get/95493/158289418.410/0_1797f7_20c08997_XL.jpg

Кушелев: Профессиональный музыкант и преподаватель взялся сделать аранжировку для музыки белков с размером 14/4: https://cloud.mail.ru/public/6KAS/wJHmX4hTK