Перевести страницу

Классическая волновая физика радиоэфира Фарадея-Максвелла

Рубиновая энергетика и эфироопорные двигатели

Пикотехнология белков

Биотехнология вечной молодости

Исследования мегалитов

Инопланетная инженерия




Пикотех - коррелляция первичной последовательности и вторичной структуры белка

Формы, механизмы, энергия наномира. Сообщение 84 388

Пикотехнология белков, ДНК, РНК - 2

http://www.rcsb.org/pdb/explore/explore … ureId=2ND1

http://www.uniprot.org/uniprot/O60885

http://www.ebi.ac.uk/ena/data/view/AAL26987

>ENA|AAL26987|AAL26987.1 Homo sapiens (human) bromodomain-containing 4
ATGTCTGCGGAGAGCGGCCCTGGGACGAGATTGAGAAATCTGCCAGTAATGGGGGATGGA
CTAGAAACTTCCCAAATGTCTACAACACAGGCCCAGGCCCAACCCCAGCCAGCCAACGCA
GCCAGCACCAACCCCCCGCCCCCAGAGACCTCCAACCCTAACAAGCCCAAGAGGCAGACC
AACCAACTGCAATACCTGCTCAGAGTGGTGCTCAAGACACTATGGAAACACCAGTTTGCA
TGGCCTTTCCAGCAGCCTGTGGATGCCGTCAAGCTGAACCTCCCTGATTACTATAAGATC
ATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAAAACAACTATTACTGG
AATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAATTGTTACATCTACAAC
AAGCCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAA
ATAAATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGA
CGTGGGAGGAAAGAAACAGGGACAGCAAAACCTGGCGTTTCCACGGTACCAAACACAACT
CAAGCATCGACTCCTCCGCAGACCCAGACCCCTCAGCCGAATCCTCCTCCTGTGCAGGCC
ACGCCTCACCCCTTCCCTGCCGTCACCCCGGACCTCATCGTCCAGACCCCTGTCATGACA
GTGGTGCCTCCCCAGCCACTGCAGACGCCCCCGCCAGTGCCCCCCCAGCCACAACCCCCA
CCCGCTCCAGCTCCCCAGCCCGTACAGAGCCACCCACCCATCATCGCGGCCACCCCACAG
CCTGTGAAGACAAAGAAGGGAGTGAAGAGGAAAGCAGACACCACCACCCCCACCACCATT
GACCCCATTCACGAGCCACCCTCGCTGCCCCCGGAGCCCAAGACCACCAAGCTGGGCCAG
CGGCGGGAGAGCAGCCGGCCTGTGAAACCTCCAAAGAAGGACGTGCCCGACTCTCAGCAG
CACCCAGCACCAGAGAAGAGCAGCAAGGTCTCGGAGCAGCTCAAGTGCTGCAGCGGCATC
CTCAAGGAGATGTTTGCCAAGAAGCACGCCGCCTACGCCTGGCCCTTCTACAAGCCTGTG
GACGTGGAGGCACTGGGCCTACACGACTACTGTGACATCATCAAGCACCCCATGGACATG
AGCACAATCAAGTCTAAACTGGAGGCCCGTGAGTACCGTGATGCTCAGGAGTTTGGTGCT
GACGTCCGATTGATGTTCTCCAACTGCTATAAGTACAACCCTCCTGACCATGAGGTGGTG
GCCATGGCCCGCAAGCTCCAGGATGTGTTCGAAATGCGCTTTGCCAAGATGCCGGACGAG
CCTGAGGAGCCAGTGGTGGCCGTGTCCTCCCCGGCAGTGCCCCCTCCCACCAAGGTTGTG
GCCCCGCCCTCATCCAGCGACAGCAGCAGCGATAGCTCCTCGGACAGTGACAGTTCGACT
GATGACTCTGAGGAGGAGCGAGCCCAGCGGCTGGCTGAGCTCCAGGAGCAGCTCAAAGCC
GTGCACGAGCAGCTTGCAGCCCTCTCTCAGCCCCAGCAGAACAAACCAAAGAAAAAGGAG
AAAGACAAGAAGGAAAAGAAAAAAGAAAAGCACAAAAGAAAAGAGGAAGTGGAAGAGAAT
AAAAAAAGCAAAGCCAAGGAACCTCCTCCTAAAAAGACGAAGAAAAATAATAGCAGCAAC
AGCAATGTGAGCAAGAAGGAGCCAGCGCCCATGAAGAGCAAGCCCCCTCCCACGTATGAG
TCGGAGGAAGAGGACAAGTGCAAGCCTATGTCCTATGAGGAGAAGCGGCAGCTCAGCTTG
GACATCAACAAGCTCCCCGGCGAGAAGCTGGGCCGCGTGGTGCACATCATCCAGTCACGG
GAGCCCTCCCTGAAGAATTCCAACCCCGACGAGATTGAAATCGACTTTGAGACCCTGAAG
CCGTCCACACTGCGTGAGCTGGAGCGCTATGTCACCTCCTGTTTGCGGAAGAAAAGGAAA
CCTCAAGCTGAGAAAGTTGATGTGATTGCCGGCTCCTCCAAGATGAAGGGCTTCTCGTCC
TCAGAGTCGGAGAGCTCCAGTGAGTCCAGCTCCTCTGACAGCGAAGACTCCGAAACAGAG
ATGGCTCCGAAGTCAAAAAAGAAGGGGCACCCCGGGAGGGAGCAGAAGAAGCACCATCAT
CACCACCATCAGCAGATGCAGCAGGCCCCGGCTCCTGTGCCCCAGCAGCCGCCCCCGCCT
CCCCAGCAGCCCCCACCGCCTCCACCTCCGCAGCAGCAACAGCAGCCGCCACCCCCGCCT
CCCCCACCCTCCATGCCGCAGCAGGCAGCCCCGGCGATGAAGTCCTCGCCCCCACCCTTC
ATTGCCACCCAGGTGCCCGTCCTGGAGCCCCAGCTCCCAGGCAGCGTCTTTGACCCCATC
GGCCACTTCACCCAGCCCATCCTGCACCTGCCGCAGCCTGAGCTGCCCCCTCACCTGCCC
CAGCCGCCTGAGCACAGCACTCCACCCCATCTCAACCAGCACGCAGTGGTCTCTCCTCCA
GCTTTGCACAACGCACTACCCCAGCAGCCATCACGGCCCAGCAACCGAGCCGCTGCCCTG
CCTCCCAAGCCCGCCCGGCCCCCAGCCGTGTCACCAGCCTTGACCCAAACACCCCTGCTC
CCACAGCCCCCCATGGCCCAACCCCCCCAAGTGCTGCTGGAGGATGAAGAGCCACCTGCC
CCACCCCTCACCTCCATGCAGATGCAGCTGTACCTGCAGCAGCTGCAGAAGGTGCAGCCC
CCTACGCCGCTACTCCCTTCCGTGAAGGTGCAGTCCCAGCCCCCACCCCCCCTGCCGCCC
CCACCCCACCCCTCTGTGCAGCAGCAGCTGCAGCAGCAGCCGCCACCACCCCCACCACCC
CAGCCCCAGCCTCCACCCCAGCAGCAGCATCAGCCCCCTCCACGGCCCGTGCACTTGCAG
CCCATGCAGTTTTCCACCCACATCCAACAGCCCCCGCCACCCCAGGGCCAGCAGCCCCCC
CATCCGCCCCCAGGCCAGCAGCCACCCCCGCCGCAGCCTGCCAAGCCTCAGCAAGTCATC
CAGCACCACCATTCACCCCGGCACCACAAGTCGGACCCCTACTCAACCGGTCACCTCCGC
GAAGCCCCCTCCCCGCTTATGATACATTCCCCCCAGATGTCACAGTTCCAGAGCCTGACC
CACCAGTCTCCACCCCAGCAAAACGTCCAGCCTAAGAAACAGGAGCTGCGTGCTGCCTCC
GTGGTCCAGCCCCAGCCCCTCGTGGTGGTGAAGGAGGAGAAGATCCACTCACCCATCATC
CGCAGCGAGCCCTTCAGCCCCTCGCTGCGGCCGGAGCCCCCCAAGCACCCGGAGAGCATC
AAGGCCCCCGTCCACCTGCCCCAGCGGCCGGAAATGAAGCCTGTGGATGTCGGGAGGCCT
GTGATCCGGCCCCCAGAGCAGAACGCACCGCCACCAGGGGCCCCTGACAAGGACAAACAG
AAACAGGAGCCGAAGACTCCAGTTGCGCCCAAAAAGGACCTGAAAATCAAGAACATGGGC
TCCTGGGCCAGCCTAGTGCAGAAGCATCCGACCACCCCCTCCTCCACAGCCAAGTCATCC
AGCGACAGCTTCGAGCAGTTCCGCCGCGCCGCTCGGGAGAAAGAGGAGCGTGAGAAGGCC
CTGAAGGCTCAGGCCGAGCACGCTGAGAAGGAGAAGGAGCGGCTGCGGCAGGAGCGCATG
AGGAGCCGAGAGGACGAGGATGCGCTGGAGCAGGCCCGGCGGGCCCATGAGGAGGCACGT
CGGCGCCAGGAGCAGCAGCAGCAGCAGCGCCAGGAGCAACAGCAGCAGCAGCAACAGCAA
GCAGCTGCGGTGGCTGCCGCCGCCACCCCACAGGCCCAGAGCTCCCAGCCCCAGTCCATG
CTGGACCAGCAGAGGGAGTTGGCCCGGAAGCGGGAGCAGGAGCGAAGACGCCGGGAAGCC
ATGGCAGCTACCATTGACATGAATTTCCAGAGTGATCTATTGTCAATATTTGAAGAAAAT
CTTTTCTGA

Композиционный код:

1,3,4,1,1,1,3,4,4,3,1,3,3,4,2,2,1,4,3,2,2,3,3,1,3,1,3,2,2,1,1,1,1,3,1,1,2,1,1,2,1,1,1,1,1,4,1,2,1,1,
1,1,3,1,1,1,1,1,1,1,1,3,4,3,1,4,1,3,4,4,1,1,2,2,1,3,1,1,3,2,1,3,1,1,1,3,4,3,1,1,1,4,1,1,3,3,1,3,1,1,
3,3,4,3,1,3,1,2,2,2,1,1,1,1,3,1,1,3,1,1,3,3,1,3,3,1,1,1,1,1,3,1,3,2,3,3,1,1,1,1,1,3,2,3,1,2,1,3,1,2,
3,3,4,3,1,1,1,1,3,3,2,3,1,2,1,2,3,3,1,1,1,1,2,1,1,2,3,2,3,2,3,4,1,3,3,2,4,2,2,3,3,1,3,1,4,2,2,1,2,3,
3,2,4,3,3,4,1,1,1,1,3,1,4,3,3,3,3,4,1,1,4,3,1,1,1,3,1,1,1,4,1,1,1,1,1,1,3,1,1,2,4,4,3,1,1,2,4,1,4,1,
4,2,4,1,1,1,2,3,1,2,1,3,2,3,1,1,1,2,1,1,1,2,1,1,1,4,1,1,2,1,3,4,1,2,1,1,2,4,1,1,3,2,1,1,1,1,1,1,1,3,
1,1,3,1,1,2,1,4,4,1,4,1,1,1,1,1,1,4,1,1,4,4,1,1,1,4,3,4,3,3,2,1,1,1,4,1,1,3,1,1,1,2,2,2,1,1,1,1,1,1,
4,1,1,1,1,1,1,1,1,1,1,1,1,1,3,1,1,1,1,1,1,1,1,1,1,1,1,1,3,4,1,4,1,2,4,1,2,1,1,1,3,1,1,1,1,1,1,1,1,1,
1,2,1,1,3,3,4,1,1,3,1,1,3,3,3,1,1,3,3,3,1,1,2,1,1,1,1,1,1,3,1,1,1,3,3,1,3,1,4,4,1,1,1,1,1,1,1,3,4,1,
3,1,1,3,1,1,1,4,1,1,3,1,1,2,4,4,1,4,1,1,4,2,4,1,3,1,1,1,3,4,1,4,1,2,1,1,1,1,1,1,3,1,1,4,1,3,1,3,4,3,
3,1,3,1,1,1,2,1,1,4,4,3,1,1,1,1,1,1,3,1,4,1,1,1,3,2,1,1,3,1,1,1,1,1,3,2,1,3,1,1,3,1,1,1,3,1,3,3,3,1,
1,3,3,3,1,3,4,3,1,3,3,3,1,3,1,1,3,3,3,3,3,1,4,1,3,3,3,1,1,1,1,3,4,1,1,1,1,2,4,1,1,1,1,1,1,3,1,4,3,1,
4,1,3,1,1,1,1,1,3,1,1,3,1,1,1,4,1,1,1,1,1,1,1,1,1,1,1,1,1,4,1,1,4,4,1,1,1,1,2,4,1,1,1,4,1,3,1,1,1,1,
1,3,3,1,1,3,1,1,4,1,4,1,2,4,3,1,4,1,1,3,1,1,1,3,1,4,1,3,1,3,3,3,3,1,3,3,3,4,3,1,1,1,1,1,1,1,1,1,4,1,
2,1,4,1,1,1,3,1,1,1,1,3,1,1,3,1,1,3,2,1,1,3,4,1,2,3,1,1,4,1,1,4,1,1,1,1,1,1,3,3,1,1,3,1,1,1,1,1,1,4,
3,3,4,1,1,1,4,1,4,3,1,1,1,1,2,4,3,2,3,4,1,1,3,1,1,4,2,1,4,3,1,2,1,1,1,4,1,1,2,1,4,4,1,1,1,4,1,2,1,1,
3,1,1,1,4,1,1,4,1,1,1,1,2,1,1,1,3,1,1,1,1,1,1,1,1,1,1,4,1,4,4,1,3,1,4,1,3,1,4,1,1,4,3,1,1,1,3,2,1,3,
1,1,1,1,2,4,1,3,3,2,3,1,1,1,2,2,1,1,1,2,2,4,1,1,1,2,1,3,1,4,3,1,1,1,1,4,1,2,1,4,2,2,1,1,1,3,2,1,4,1,
2,1,1,1,1,1,3,1,1,3,4,4,4,1,3,3,1,2,3,1,2,1,1,1,1,1,1,1,1,4,1,4,1,1,4,1,1,4,1,1,3,4,4,2,1,3,1,4,1,4,
1,1,1,1,2,1,1,4,4,1,2,1,1,1,3,4,1,1,1,4,1,1,1,4,2,2,1,2,2,1,1,1,1,3,2,1,1,1,1,3,1,1,3,2,4,1,4,1,1,1,
1,1,1,3,1,1,1,1,3,1,1,4,2,1,1,1,1,1,1,1,3,4,1,2,1,1,1,2,1,4,4,1,3,1,1,3,1,3,1,1,1,1,1,3,2,1,4,1,1,1,
4,1,1,1,2,1,3,1,1,1,3,1,1,1,4,3,1,2,3,1,1,1,1,2,1,1,1,1,4,1,1,1,3,2,1,1,3,1,1,1,3,1,3,1,1,4,3,3,1,1,
4,1,1,1,1,1,1,4,4,4,1,1,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,4,4,4,4,1,1,1,1,1,4,1,1,1,1,1,1,1,1,4,1,1,4,4,
3,1,1,3,4,3,1,4,1,3,4,1,4,1,2,1,1,1,2,4,2,2,4,1,3,1,1,1,3,1,3,1,1,4,1,3,2,3,4,1,3,1,1,4,3,1,1,1,1,1,
1,1,1,1,2,4,1,1,3,4,1,1,1,1,1,2,1,1,2,1,1,1,1,1,1,1,1,1,1,1,3,4,1,3,1,1,3,1,1,1,4,1,3,1,1,1,1,3,1,1,
1,1,1,4,4,4,1,1,1,1,1,1,2,1,1,1,3,4,4,1,1,1,4,4,1,3,1,1,2,3,4,1,1,1,1,1,1,1,1,1,1,1,3,1,1,1,1,3,1,3,
2,3,4,4,3,1,1,1,1,2,1,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,1,1,4,1,4,1,1,1,2,3,1,4,3,1,1,2,3,1,3,1,1,3,1,1,
3,3,2,1,2,2,3,3,3,3,3,1

Вторичная структура (Пикотех): https://img-fotki.yandex.ru/get/195419/ … 4_orig.gif

https://img-fotki.yandex.ru/get/122076/158289418.3bf/0_170243_1d83303d_orig.png
Кушелев: Любопытный фрагмент структуры...

https://img-fotki.yandex.ru/get/224193/158289418.3bf/0_170244_9266a9c0_orig.png

https://img-fotki.yandex.ru/get/95629/158289418.3bf/0_170245_af9b706f_orig.png

https://img-fotki.yandex.ru/get/198488/158289418.3bf/0_170246_38a453a9_orig.png

https://img-fotki.yandex.ru/get/196142/158289418.3bf/0_170247_b39cbdc0_orig.png

https://img-fotki.yandex.ru/get/43388/158289418.3bf/0_170248_c78de507_orig.png

Кушелев: Интересно, что это за участки белка такие необычные?

https://img-fotki.yandex.ru/get/196486/158289418.3bf/0_17025e_97b8bb30_orig.png
Кушелев: Обратите внимание на корреляцию вторичной структуры с аминокислотными остатками. Gln (глутамин) находится в структуре прямой альфа-спирали, а Pro (пролин) в структуре бета-спирали и краёв.



Формы, механизмы, энергия наномира. Сообщение 84 389

Пикотехнология белков, ДНК, РНК - 2

https://img-fotki.yandex.ru/get/196486/158289418.3bf/0_17025e_97b8bb30_orig.png
Кушелев: Все видят корреляцию?

https://img-fotki.yandex.ru/get/196010/158289418.3bf/0_17027c_adf3ee8_orig.png
Такая корреляция наглядно показывает предсказательную силу пикотехнологии даже на уровне 2D-структуры.

https://img-fotki.yandex.ru/get/61266/158289418.3bf/0_17027d_df19ad12_orig.png

https://img-fotki.yandex.ru/get/197923/158289418.3bf/0_17028e_455c9b30_orig.png

https://img-fotki.yandex.ru/get/195637/158289418.3bf/0_1702b1_a19e23f8_orig.png

https://img-fotki.yandex.ru/get/114207/158289418.3bf/0_1702b2_8171e69d_orig.png

https://img-fotki.yandex.ru/get/55918/158289418.3bf/0_1702b3_c5186377_orig.png

Кушелев: Корреляция вторичной структуры по таблице композиционного кода с первичной последовательностью белка, в частности, иминокислоты Pro, очевидна.


А первичная последовательность в отличие от данных РСА имеет 100%-ную надёжность smile




Кодируется ли тип спиралей белков композиционным генетическим кодом? Точность и стоимость РСА. Самоповерка пикотехнологии.

Kushelev пишет:Victoriy пишет:

третий нуклеотид кодонов детерминирует лишь один из трех разновидностей вторичных структур в белке: спираль, бета-тяж или поворот. За разновидности спиралей отвечает специфика хвостов аминокислотных остатков в них входящих. А это уже не к коду, а к фолдингу.

Кушелев: Тут интересно было бы разобраться подробнее. Вот типовой участок 310-спирали:

http://nanoworld88.narod.ru/data/209_files/0_48027_3b50efe_orig.gif
Мы видим коды 310-спирали (N4) по моей таблице композиционного генетического кода: http://nanoworld88.narod.ru/data/212.htm

Вы не могли бы с помощью своего алгоритма построить участок структуры белка по входным данным:

FT   CDS 1..48
gctctgctgc tgctggcgtc ggcgctgctc gtgtcgctga cgcacaca
//

Очень интересно посмотреть, получится ли по Вашему алгоритму 310-спираль этого белка (гонадотропина)?

Я предполагаю, что Ваш алгоритм выдаст вместо 310-спирали альфа-спираль...

Милейший Александр Юрьевич, мы так долго и упорно это обсуждали в своё время, что остались каждый при своём мнении, своей таблице и своей программе моделирования структуры белков. Не втягивайте меня в обсуждение снова. Если этот вопрос Вас не отпускает можно вернуться в архив форума и всё пересмотреть и даже пережить снова.


Victoriy пишет:

мы так долго и упорно это обсуждали в своё время, что остались каждый при своём мнении

Кушелев: Уважаемая Виктория! Я что-то не припомню, чтобы Вы строили модель и получали PDB-файл по этим данным:

FT   CDS 1..48
gctctgctgc tgctggcgtc ggcgctgctc gtgtcgctga cgcacaca

Не дадите ссылку?


Дело в том, что Андрей интересовался, в чём отличие наших с Вами алгоритмов. Я думаю, что на этом примере будет хорошо видно это отличие. Нужно только получить PDB-файл по этим данным с помощью Вашей программы. А я могу получить PDB-файл по этим же данным с помощью программы Пикотех.

***
Пример PDB-файла (фрагмент гонадотропина), полученного с помощью программы Пикотех:


http://img-fotki.yandex.ru/get/6300/126580004.51/0_bc7ac_b07933_L.gif


Цитата:

α-спираль, или спираль 413

310-спираль — очень «тугая» спираль, в сечении имеет форму треугольника, в белках встречается в основном её правая форма, и то только в виде 1-2 витков


Victoriy пишет:

А.Ю., Андрею ни холодно, ни жарко от нюансов отличий между нашими программами, а с Вами я не хочу повторно это обсуждать. Почитайте мою монографию, там всё очень подробно написано.

Кушелев: К сожалению, в книге нет модели 310-спирали, например, модели фрагмента гонадотропина, построенной с помощью Вашего алгоритма. Вот мне и хотелось бы увидеть, что же реально будет построено по Вашему алгоритму, если дать ему входные данные фрагмента гонадотропина:

FT   CDS 1..48
gctctgctgc tgctggcgtc ggcgctgctc gtgtcgctga cgcacaca
//

Давайте вместе посмотрим на результат работы Вашего алгоритма. А Вы его прокомментируете. Мне очень интересно узнать Ваши комментарии.

А у Андрея интерес не праздный. Его тоже спросят, почему два варианта PDB-файлов? В чём различие? Вот я и предлагаю наглядно показать различие на примере фрагмента гонадотропина. Ведь его структура надёжно установлена, т.к. длина 310-спирали существенно отличается от длины альфа-спирали. Это даже РСА "видит" smile



Kushelev пишет:

Цитата:

α-спираль, или спираль 413

310-спираль — очень «тугая» спираль, в сечении имеет форму треугольника, в белках встречается в основном её правая форма, и то только в виде 1-2 витков

Цитата-2: π-спираль, или спираль 516, — спираль с широкими витками, в результате в центре спирали остаётся пустое пространство. В белках встречается редко, обычно не более одного витка.

http://img-fotki.yandex.ru/get/6302/126580004.52/0_bcc2f_a96d98c5_M.gif
Подробнее: http://nanoworld.org.ru/topic/301/

Кушелев: Согласно моей таблице композиционного генетического кода пи-спираль (спираль 516) кодируется периодическим кодом 3333333333333

Такой код как раз встречается во входных данных белков TFIIB:

https://img-fotki.yandex.ru/get/117578/158289418.3a4/0_16bc45_ac39775f_XL.png

и TBP1:

https://img-fotki.yandex.ru/get/196161/158289418.3a4/0_16cb20_65b2de08_XL.png

Если в PDB-файле вместо пи-спирали у Вас что-то другое, то что? А если пи-спираль, то по какому алгоритму она получена, если не по моей таблице композиционного кода? smile


Участок белка TFIIB с 270 по 284 выделен зелёным цветом. На него указывают зелёные стрелки.

https://img-fotki.yandex.ru/get/194503/158289418.3a4/0_16cb4b_aa29efdf_XL.jpg

Мы видим, что по алгоритму Виктории Соколик тут получилась такая же 310-спираль в том числе и на участке, где по программе 2D нет никакой спирали. Вот мне и интересно, как же получена в 3D-алгоритме 310-спираль, если не по моей таблице композиционного генетического кода?


Skype, 2016-12-13:

[19:40:44] Andrei: интересно а как вообще фирмы для себя белок выбирают
[19:40:53] Andrei: например медицинские
[19:41:17] Andrei: сидят и гадают какой белок взять?
[19:42:09] Кушелев Александр Юрьевич: Там много всяких способов. Фармацевты иногда всё подряд проверяют. Генные инженеры комбинируют гены, биотехнологи модифицируют гены...
[19:42:36] Andrei: а как все подряд?
[19:42:41] Andrei: откуда берут белки?
[19:43:27] Andrei: надо же как-то синтезировать из кусков
[19:43:37] Andrei: кодировать
[19:43:56] Andrei: надо погуглить
[19:47:37] Кушелев Александр Юрьевич: В человеческом организме около 5 000 000 разных видов белков. А есть ещё в других организмах животных и растений. Вот все подряд и пробуют smile
[19:48:33] Andrei: а почему нельзя конструктор сделать из всех кодонов?
[19:48:38] Andrei: их же 20 всего
[19:49:40] Кушелев Александр Юрьевич: Можно. Я даже вручную делал: https://www.youtube.com/watch?v=nVYnVZv6Qr8
[19:49:58] Кушелев Александр Юрьевич: Эти модели были сделаны в 1992...1994 годах
[19:50:11] Andrei: я про настоящие smile
[19:50:24] Кушелев Александр Юрьевич: На них я как раз и составил таблицу композиционного генетического кода.
[19:51:00] Кушелев Александр Юрьевич: А из настоящих аминокислот белки собирает органелла клетки рибосома. По генетическому коду
[19:51:25] Andrei: ну вот, генетический код каждый раз новый подсовывать
[19:51:44] Кушелев Александр Юрьевич: Генные инженеры этим и занимаются
[19:52:14] Кушелев Александр Юрьевич: Но лучше сначала на компьютере через секунду результат увидеть, а если подходит, тогда уже синтезировать из настоящих
[19:52:28] Andrei: так а что там смотреть?
[19:52:38] Andrei: одни загуговины smile
[19:52:48] Кушелев Александр Юрьевич: Структуру. По ней можно догадаться, подойдёт нам этот белок или ну его...
[19:53:17] Andrei: как?
[19:53:20] Кушелев Александр Юрьевич: Для неспециалиста внешний вид экскаватора ничего не даёт. На крайний случай назовут камнеедом, если увидят в работе
[19:53:41] Кушелев Александр Юрьевич: А если на стоянке, то могут вообще не догадаться, что за хрень
[19:53:52] Andrei: на мохнатость структуры смотрят?
[19:54:16] Кушелев Александр Юрьевич: Там на всё смотрят. А я даже по звуку могу определить, где активные центры белка находятся
[19:54:27] Andrei: звуку чего?
[19:54:34] Кушелев Александр Юрьевич: По звуку сборки белка
[19:55:22] Andrei: откуда звук?
[19:55:36] Кушелев Александр Юрьевич: Аминокислоты при установке в белковую цепь отзванивают на своих частотах. Можете послушать звучание сборки активного центра белка коллагена: http://www.nanoworld.org.ru/data/01/data/sounds/c01.mp3
[19:56:18] Andrei: а на бояне кто там играет?
[19:56:23] Andrei: тоже белок?
[19:56:46] Кушелев Александр Юрьевич: Это моя аранжировка
[19:57:02] Andrei: так и не понял откуда частота взялась
[19:57:13] Кушелев Александр Юрьевич: Программа Пикотех выдаёт музыку в стандарте MIDI
[19:57:19] Andrei: аа
[19:57:50] Кушелев Александр Юрьевич: Частота рассчитывается по формуле Томсона для математического и пружинного маятников. По длине радикалов аминокислотных остатков
[19:57:58] Andrei: интересно
[19:58:08] Andrei: вот это может сработать
[19:58:24] Кушелев Александр Юрьевич: На эту тему была снята ТВ-передача "Музыка молекул" в 1992-ом году
[19:58:39] Кушелев Александр Юрьевич: Там ного чего уже сработало
[19:59:44] Кушелев Александр Юрьевич: Например, в 2015-ом году вышла статья физиков из Германии, где они "нащупали" с помощью АСМ (атомного силового микроскопа) кольцевые грани атомов: http://nanoworld88.narod.ru/data/493.htm
[20:00:15] Кушелев Александр Юрьевич: Это - экспериментальное подтверждение результатов моих модельных экспериментов.
[20:01:12] Кушелев Александр Юрьевич: Ну и не забывайте, что учебные пособия с пикотехнологическими моделями молекул и кристаллов уже изучают в школах России с 2004 года: http://nanoworld88.narod.ru/data/250.htm



[20:02:37] Andrei: о как
[20:02:41] Andrei: интересно
[20:02:56] Andrei: жаль пока приспособить некуда
[20:04:22] Andrei: так написано что Снельсон это изобрел
[20:06:50] Кушелев Александр Юрьевич: Снельсон открыл кольцегранный микромир уже в 1960-ом году. В 1963-ем вышла его первая статья с моделями атомов. Но ... до белков он не добрался.
[20:07:20] Кушелев Александр Юрьевич: А Збигнев Огжевальский доложил о кольцегранных моделях атомов, молекул и кристаллов ещё в 1957-ом.
[20:07:34] Кушелев Александр Юрьевич: Про Снельсона я узнал в 2003-ем, а про Огжевальского в 2007-ом.
[20:09:10] Кушелев Александр Юрьевич: Пикотехнология белков базируется на моём научном открытии композиционного генетического кода. Если найдёте ещё одного открывателя, который опубликовал таблицу композиционного генетического кода раньше меня, т.е. до 1992 года, то будет очень интересно smile
[20:10:18] Кушелев Александр Юрьевич: Таблица композиционного кода выделена голубым цветом. Публикация 1993 года:

http://nanoworld88.narod.ru/data/230_files/0_4a672_1493e464_XL.jpg



[20:12:40] Andrei: в чем открытие?
[20:12:49] Andrei: комбинация кодонов?
[20:17:14] Кушелев Александр Юрьевич: Открытие заключается в том, что три буквы кодируют не только аминокислоту, но и угол поворота этой аминокислоты относительно предыдущей:

http://nanoworld88.narod.ru/data/216_files/bio.gif

[20:17:59] Кушелев Александр Юрьевич: Этот угол (и формы аминокислот) как раз и открывают возможность определять структуры белков по таблице
[20:18:08] Andrei: а что не знали что углы есть?
[20:18:17] Кушелев Александр Юрьевич: Знали
[20:18:23] Кушелев Александр Юрьевич: Но не знали, что эти углы кодируются


[20:18:52] Andrei: то есть закручиваться по разному может спираль?
[20:19:55] Кушелев Александр Юрьевич: Куда аминокислоту повернули, туда и пойдёт расти белковая "цепь"
[20:20:13] Кушелев Александр Юрьевич: А там три крупных варианта поворота, т.е. через 120 градусов
[20:20:28] Кушелев Александр Юрьевич: Но есть нюансы, с которыми не соглашается Виктория Соколик.
[20:20:54] Andrei: почему только 3 угла?
[20:21:01] Andrei: кодонов ведь больше
[20:21:30] Кушелев Александр Юрьевич: Например, один из вариантов расщепляется ещё на три. Одиночный альфа-вариант, альфа-вариант в структуре альфа-спирали и альфа-вариант в структуре 310-спирали. Есть и другие нюансы, но не буду Вас перегружать smile
[20:21:41] Кушелев Александр Юрьевич: Кодонов 64
[20:22:06] Кушелев Александр Юрьевич: Они кодируют 23 аминокислоты, если считать изомеры
[20:22:17] Andrei: так на каждый кодон свой угол?
[20:22:20] Кушелев Александр Юрьевич: Но для этого достаточно всего двух букв
[20:22:27] Кушелев Александр Юрьевич: Почти на каждый
[20:22:59] Кушелев Александр Юрьевич: Есть кодон-терминатор, который означает конец строительства белковой молекулы. Таких даже два разных.
[20:23:23] Andrei: на что влияет угол?
[20:24:20] Кушелев Александр Юрьевич: В таблице моё открытие выделено зеленым цветом:

http://nanoworld88.narod.ru/data/302_files/0_bcbf2_14392c02_orig.png

[20:24:33] Кушелев Александр Юрьевич: Угол влияет на направления роста структуры белка
[20:24:43] Andrei: всего 4 угла?
[20:26:08] Кушелев Александр Юрьевич: Их гораздо больше, но у Виктории в таблице 3 варианта, у меня 4, а в алгоритме Пикотехнология в данный момент 5.
[20:26:46] Кушелев Александр Юрьевич: Более того, некоторые из углов, например, в иминокислоте пролин могут сильно меняться, т.е. на десятки градусов.
[20:28:32] Кушелев Александр Юрьевич: Но пока я работаю по упрощённому алгоритму, т.е. без учёта физико-химических взаимодействий. Но даже на этом уровне результаты очень близки к реальности. А связано это с тем, что композиционный генетический код в процессе эволюции стал дублировать физико-химические взаимодействия на подавляющем большинстве участков белка.
[20:29:35] Andrei: должно быть какое-то практическое применение кроме красивости
[20:30:10] Andrei: чтобы можно было как-то свойства прогнозировать
[20:32:36] Кушелев Александр Юрьевич: Так практическое применение и заключается в том, что по старой технологии нужно заплатить 10 000 евро и ждать месяцы или годы, чтобы увидеть 3D-структуру белка, входящего в 3%, которые кристаллизуются.
[20:33:25] Кушелев Александр Юрьевич: А по новой технологии даёте нуклеотидную последовательность, и через секунду смотрите структуру любого, т.е. 3%+97% белка, причём в 1000 раз точнее.


Татьяна Рясина пишет:

Значит Пикософт видит участки, которые не видит и не показывает РСА?
Т.е. Пикософт показывает "белые пятна"или "пустые зоны" РСА?

Кушелев: Начну с того, что РСА применим только к кристаллам, т.е. 97% белков РСА вообще "не видит" smile

Из структур 3% белков, которые кристаллизуются, начальные и конечные участки до 50 аминокислотных остатков (до 1000 атомов) РСА тоже "не видит".

На примере ряда белковых структур мы видим, что РСА часто(!) не позволяет определить даже тип белка, т.е. может показать много альфа-спиралей, где их нет вообще или не показать там, где их много.

Реальная погрешность РСА - это габарит белковой молекулы. Чем крупнее молекула, тем больше возможная погрешность РСА. Но бывают и "счастливые случаи", когда по ряду дополнительных данных удаётся однозначно определить структуру белковой молекулы. Например, установлено, что инсулин состоит из двух гнутых участков спирали. Пикотех это подтверждает на все 100%


http://img-fotki.yandex.ru/get/5414/126580004.3d/0_b0f20_2c87f90a_orig.gif  

Подробнее: http://nanoworld.org.ru/topic/199/page/43/ , http://nanoworld88.narod.ru/data/276.htm
Эти два участка спиралей соединяются ещё на стадии проинсулина.



РСА (ЧЕРЕЗ ПОИСК ФОРУМА ЛАБОРАТОРИИ НАНОМИР)

http://nanoworld.org.ru/search/1376839994/ 

Рентгенограммы РСА 

Результаты анализа рентгенограмм РСА 

97% белков не кристаллизуеся. Системные ошибки РСА 

РСА может показать чего нет и не показать что есть  

РСА цены   ,   , 

Точность РСА   ,   ,   ,     ,  

Корреляция данных РСА с Пикотех  

РСА стремится к Пикотех 

Лауэграммы и ренгенограммы  ,  

Молекула лизоцима 




http://www.vokrugsveta.ru/telegraph/theory/1071/

https://img-fotki.yandex.ru/get/194492/158289418.3a7/0_16df1f_9732efdb_XL.jpg
Цитата: Фотоотчет о выращивании белковых кристаллов на МКС во время 12-й экспедиции с 1 октября 2005 по 8 апреля 2006 года. Рост одного кристалла занимал 25 дней. Фото: NASA


Skype, 2016-12-21:

[20:05:27] Кушелев Александр Юрьевич: 500 000 / 120 = 4167 USD за один кристалл белка. Добавьте сюда сопутствующие работы, например, собственно РСА и анализ данных.
[21:04:47] Кушелев Александр Юрьевич: Вам эти фразы должны понравиться:

https://img-fotki.yandex.ru/get/61266/158289418.3a7/0_16df20_8cf98a5a_XL.jpg
"из невразумительных точек и кругов с помощью специальных математических преобразований получают информацию о расположении атомов. Для неспециалистов выглядят как шарлатанство. Даже если решетка несложной формы, эта задача непростая, но все честно." Подробнее: http://www.vokrugsveta.ru/telegraph/theory/1071/
[21:09:54] Кушелев Александр Юрьевич: При большом везении при переборе 600 условий кристаллизации найдется 1–2 раствора, в которых появятся кристаллы. Как правило, на первом этапе они небольшие, непрозрачные и совершенно неправильной формы, то есть не подходящие для рентгеноструктурного анализа.
[21:15:41] Кушелев Александр Юрьевич: Вот ещё цитата о цене белкового кристалла:  На получение одного кристалла белка ученые могут потратить десятки тысяч евро, а фармацевтические компании готовы заплатить еще большие деньги за подробную информацию о структуре какого-нибудь важного для медицины белка — «замка», к которому можно подбирать «отмычку» — лекарство.


Skype, 2016-12-21:

[19:54:52] Кушелев Александр Юрьевич: Например, узнайте цену структуры белка, кристалл которого нужно выращивать 2 года smile
[19:55:12] Andrei: речь не обо мне а о вас, знаете ли вы цену или просто придумываете smile
[19:59:00] Кушелев Александр Юрьевич: Мне сказали цену специалисты из лаборатории РСА
[19:59:15] Кушелев Александр Юрьевич: Кстати, почитайте ещё раз, как проводится анализ: http://bio.1september.ru/view_article.php?ID=200900401
[20:00:25] Andrei: Сказать это одно, а заказать другое:)
[20:01:35] Кушелев Александр Юрьевич: Вот сюда позвоните и спросите, сколько будет стоить кристаллизация белка (минимум и максимум): http://www.piboc.dvo.ru/structure/ext_l … ristal.php
[20:03:14] Andrei: Ладно, это мелочь
[20:03:31] Andrei: Надо искать кому это нужно и зачем
[20:03:46] Кушелев Александр Юрьевич: Вот Вам конкретные данные:  "со ста двадцатью образцами работа еще даже не начиналась. На их восстановление потребуется не меньше полумиллиона долларов и от нескольких недель до нескольких месяцев работы." Подробнее: http://www.vokrugsveta.ru/telegraph/theory/1071/
[20:04:08] Кушелев Александр Юрьевич: 120 кристаллов белка - 500 000 долл.
[20:05:27] Кушелев Александр Юрьевич: 500 000 / 120 = 4167 USD за один кристалл белка. Добавьте сюда сопутствующие работы, например, собственно РСА и анализ данных.

https://img-fotki.yandex.ru/get/55431/158289418.3a7/0_16df1e_482d1979_XL.jpg



Татьяна Рясина пишет:

Прямые белки бывают или они обязаны быть спиральными?

Структура белковых молекул программируется:

http://img-fotki.yandex.ru/get/9229/158289418.af/0_ae26a_4c84e562_S.gif
Белок собирается из таких "кирпичиков"-аминокислот.

Подробнее: http://nanoworld.org.ru/topic/301/

Если они складываются в регулярную структуру, то получается альфа-, бета-, пи-, 310-спираль, которые кодируются соответственно композиционными кодами: 11111, 22222, 33333, 44444

Если же композиционные коды идут "в разнобой", то формируется произвольная "ломаная". Эта "ломаная" может, например, замкнуться в цикл с помощью дисульфидного мостика

Подробнее: http://nanoworld88.narod.ru/data/025.htm



Victoriy пишет:

Чтобы вторичная структура белка в виде 3/10 спирали была стабильна, и вообще сформировалась кодоны 4 должны идти хотя бы тройками подряд, чего вообще не наблюдается.

Кушелев: Вовсе нет. Чередование композиционных кодов "1" и "4" приводит лишь к изгибам спирали. Ведь она стабилизирована водородными связями. При этом стабильны и прямые спирали (альфа- и 310-), и изогнутые участки с любой комбинацией кодов "1" и "4". Я же Вам показал, как выглядят комбинированные, т.е. гнутые спирали:

Kushelev пишет:

Есть прямые альфа-спирали, где все композиционные коды 11111111111111111

Есть прямые 310-спирали, где все коды 4444444444444444

А большинство спиральный участков гнутые. Там коды 1 и 4 чередуются. При этом структура часто бывает периодической типа 114114114114 или 144144144144 или 111411141114

Я показывал в рассылке типовые гнутые спирали с периодическими кодами:

http://nanoworld88.narod.ru/data/298_files/0_7d8ff_4b6b2520_orig.gif

http://nanoworld88.narod.ru/data/298_files/0_7d948_be62fe10_M.jpg
Подробнее: http://nanoworld88.narod.ru/data/298.htm

http://nanoworld88.narod.ru/data/310_files/0_7da25_d7edb744_L.jpg
Подробнее: http://nanoworld88.narod.ru/data/310.htm

http://nanoworld88.narod.ru/data/209_files/0_47daa_bdcbb03_L.gif
Подробнее: http://nanoworld88.narod.ru/data/209.htm

Цитата: Как видите, плавные изгибы спирали белка можно направлять в любую сторону.


http://nanoworld.org.ru/post/80866/#p80866
diprospan:
ангиотензин
http://www.chem.msu.ru/rus/theses/2015/ … lltext.pdf
Кушелев:
Нужно будет сделать модели белков из этой диссертации

там рассматриваются вполне конкретные прикладные вещи и задачи.
прежде всего, важность АПФ (АНГИОТЕНЗИН-ПРЕВРАЩАЮЩЕГО ФЕРМЕНТА) и его критическая роль в
ренин-ангиотензин-альдостероновой системе и регуляции сердечно-сосудистой физиологии и
заболеваний, лекарства, блокирующие различные компоненты этой системы, эффективны при лечении
гипертензии, сердечной недостаточности и предупреждении сердечно-сосудистых событий, вызванных
атеросклерозом (в основном инфаркта и инсульта), а также способные замедлять болезнь почек,
вызванную гипертензией и диабетом.

Группа ингибиторов АПФ представлена широким спектром препаратов, наиболее важное значение для
клинической практики сохраняют ингибиторы - каптоприл, эналаприл и лизиноприл, как наиболее
изученные в многочисленных экспериментальных и клинических исследованиях.
а поиск и исследование более совершенных природных и синтетических ингибиторов АПФ на данный
момент является весьма актуальной задачей.

Анализ аминокислот, участвующих в процессе «открывания» и «закрывания» активного центра АПФ
авторами был осуществлён с использованием программы DynDom, доступной по адресу:
http://www.cmp.uea.ac.uk/dyndom/main.jsp
http://fizz.cmp.uea.ac.uk/dyndom/dyndomMain.do
Структура С-домена АПФ содержит 27 спиралей: 20 α-спиралей и 7 310-спиралей.
N-домен АПФ состоит из 18 α-спиралей, пяти 310-спиралей.
есть гипотеза что именно 310-спирали "акцепторны" к воздействию ингибиторов типа каптоприла и т.п.

http://s1.bild.me/bilder/240416/1256582imgs2.jpg http://s1.bild.me/bilder/240416/2351109imgs1.jpg

http://www.rcsb.org/pdb/explore/explore … ureId=1O8A

http://www.uniprot.org/uniprot/P12821

http://www.ebi.ac.uk/ena/data/view/AAA5 … play=fasta

Благодаря Diprospan, который сделал очень удачный подарок к Новому Году, мы с вами наблюдаем 310-спираль рекордной длины (17 аминокислотных остатков!), т.е. почти 6 полных витков 310-спирали.

"Такого я не видела..."


Формы, механизмы, энергия наномира. Сообщение 83 417

Victoriy пишет:

Похоже я открыла ящик Пандоры, научив А.Ю. пользоваться PDB smile.
Уважаемый Александр Юрьевич, давайте вместе проанализируем Ваш материал по кодированию различных видов спиралей на основе экспериментально показанных спиральных участков в белках 1TAG; 3SDH; 1GPB; 1PZ4; 1OBO; 1GS6; 1H1N; 1LRV и АПФ от Дипроспана. Структура последнего энзима мне лично не безразлично, т.к. его активность в сыворотке крови пациентов с лакунарными инсультами я определяла в этом году в одной из текущих НИР.
Предлагаю в скайпе голосом, а потом Вы выложите свой материал на форуме.

На форум интересно текст выложить, а не голос smile Давайте сначала разберёмся с самоповеркой пикотехнологии: http://nanoworld.org.ru/topic/1533/

Согласитесь, что таких случайностей просто не бывает smile

Кстати, эта тема имеет продолжение: http://nanoworld.org.ru/topic/1535/

Итак, вопрос для богини пикотехнологии, Виктории Соколик:

"Вы согласны, что структуры альфа-спирали, 310-спирали, фрагмента лизоцима из этой темы: http://nanoworld.org.ru/topic/1533/ однозначно подтверждают:

1. Кодирование прямой альфа-спирали кодами -1111111111111111111111-
2. Кодирование прямой 310-спирали кодами -444444444444-
3. Программирование цикла из 22 аминокислотных остатков лизоцима" ?

Если есть возражения, то жду Ваших аргументов. Пока мы не придём к консенсусу по данному вопросу, более сложные вопросы, как то нюансы статистики, я обсуждать не готов.



Формы, механизмы, энергия наномира. Сообщение 83 442

Victoriy пишет:

А.Ю., ну и чем я заслужила такую напраслину:
Виктория спорит с азами теории вероятностей;

Кушелев: Почему напраслина?

https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_L.png

Вы же утверждаете, что альфа-спираль может кодироваться и "1" и "4", но в таком случае последовательность кодов 1111111111111111111111 не имеет смысла, случайна, по той причине, что замена "1" на "4" не должно испортить прямую альфа-спираль. Но вероятность случайного возникновения последовательности из 22 единиц такая же, как монетка 44 раза упадёт на "орла". Если для Вас это - "пустой звук", значит Вы не понимаете азов теории вероятностей. Если не согласны, кидайте монетку, пока не упадёт 44 раза подряд на "орла" smile


Skype, 2016-12-25:

[22:01:39] Andrei: так никому ничего не доказать
[22:02:23] Кушелев Александр Юрьевич: Есть люди, которым не только не докажешь, но даже не покажешь wink
[22:02:28] Andrei: даже Виктория не убеждена не говоря уже о других
[22:02:35] Andrei: неубедительно
[22:05:35] Andrei: никто в такие рассказики не уверует
[22:06:03] Кушелев Александр Юрьевич: Слышали анекдот про блондинку? Её спросили: "Какова вероятность встретить на улице динозавра?"
-"Фифти-фифти". Либо встречу, либо нет smile



Victoriy пишет:

У Виктории размеры электронов/граней отличаются на порядок больше, т.е. ошибочно.

Кушелев: Сначала я определил радиусы кольцевых электронов из рефрактометрических радиусов ионов кислорода, хлора и фтора (Работа Гольдшмидта 1923г). Для ионов кислорода, хлора и фтора отличие радиусов электронов не превышало 1%. Позднее радиусы электронов удалось уточнить масштабированием белковых молекул. Ведь макромолекулы белка могут иметь гигантские размеры в масштабах микромира. Я подобрал размер кольцевого электрона таким образом, чтобы размеры белковых молекул, определённых экспериментально совпали с кольцегранными моделями в программе PiMol и HyperChem.
Совпадение размеров макромолекул получилось при диаметре кольца-электрона 1.7А.



Эволюция фрактального самопрограммирования

В процессе эволюции добелкового мира возник белковый мир, основой которого стал генетический код. В процессе эволюции появился композиционный генетический код, управляющий рибосомой эукариот.

Структуры белков чем-то напоминают ячейки Бенара, т.е. однотипные элементы.

В процессе эволюции фрактального самопрограммирования возникают маловероятные, но функциональные структуры.

https://img-fotki.yandex.ru/get/195771/158289418.3a9/0_16e45e_5079e0c_orig.png
Протяженные прямые 310-спирали (показаны красной полосой),

https://img-fotki.yandex.ru/get/176331/158289418.3a9/0_16e469_468e8c12_orig.png
Протяжённые альфа-спирали (показаны широкой красной полосой),

http://nanoworld88.narod.ru/data/288_files/0_85d09_8d7f6a3d_orig.gif
менее протяженные пи-спирали (показаны синим),

http://img-fotki.yandex.ru/get/6301/126580004.53/0_bcc39_20b9a5c1_orig.gif
и бета-спирали (показаны зеленым).

https://img-fotki.yandex.ru/get/3505/158289418.3a9/0_16e46d_b82fdb29_orig.png


http://nanoworld88.narod.ru/data/210_files/0_480da_7089f224_orig.gif
А так же их периодические комбинации.

Фрактальная архитектура белков имеет ярко выраженную аналогию с фрактальной архитектурой мегалитов.

http://nanoworld88.narod.ru/data/236_files/0_5123a_2284861d_orig.png
Подробнее: http://nanoworld88.narod.ru/data/236.htm

В структуре крупных белков прослеживается тот же фрактальный принцип.

https://img-fotki.yandex.ru/get/197102/158289418.3a8/0_16e35d_1aff86e7_XL.gif
Оригинал: https://img-fotki.yandex.ru/get/197102/ … 7_orig.gif
В середине структуры мы видим крупные спиральные блоки, а к обоим концам всё более мелкие.

http://nanoworld88.narod.ru/data/210_files/0_480e8_46d28a30_orig.gifhttp://nanoworld88.narod.ru/data/210_files/0_480df_c1431c83_orig.gif
Подробнее: http://nanoworld88.narod.ru/data/210.htm
Отдельной темой идут архитектурные и музыкальные перевертыши.

http://nanoworld88.narod.ru/data/025_files/1.gif
Шедеврами фрактальной белковой архитектуры являются многофункциональные квазиперевертыши, которые оптимально выполняют архитектурные, музыкальные и другие функции.

Именно невероятные комбинации кодов позволяют получить рекордные параметры. Вероятность случайного повторения 22 кодов прямой альфа-спирали не превышает 5.8*10^-14
Ничтожно мала вероятность случайного замыкания фрагмента лизоцима, состоящего из 22 аминокислотных остатков. Ничтожна вероятность образования 310-спирали, кодируемой 17-ю одинаковыми кодами. Ничтожна вероятность возникновения периодической структуры с циклическим повторением комбинации композиционных кодов.


А.Ю., Вы же знаете мою точку зрения по кодированию специфики спиралей: ОНА НЕ КОДИРУЕТСЯ. Вопрос не случайности в данном случае вообще голословен без статистики. Это мне напоминает перл из новогоднего старого фильма: "Есть ли жизнь на Марсе, нет ли жизни на Марсе...."
Не бойтесь, в статистике нет нюансов, там все прозрачно и математически. Я помогу в скайпе.


Kushelev пишет:

Уважаемая Виктория!
Как Вы относитесь к самоповерке пикотехнологии?

Victoriy Перестаньте увиливать от поверки с экспериментом smile.


Victoriy пишет:

А.Ю., Вы же знаете мою точку зрения по кодированию специфики спиралей: ОНА НЕ КОДИРУЕТСЯ.

Кушелев: Тогда расскажите, как Вы получаете PDB-файл 310-спирали (по моей таблице последовательность кодов 44444444444444), альфа-спирали (по моей таблице 11111111111111), пи-спирали (33333333333333333), бета-спирали (2222222222222) ?

Какие из типов вторичных структур может строить Ваша программа?

1. Альфа-спираль
2. Бета-спираль
3. Пи-спираль
4. 310-спираль

Поставьте галочки, а то я до сих пор понять не могу...


Сходство и различие генетического кода с языком

В генетическом коде любая комбинация букв ACGT является осмысленной и соответствует конкретной структуре белковой молекулы. Те же последовательности могут использоваться для кодирования сигналов и других семантических объектов.

В языке осмысленные комбинации букв (слова) представляют малое подмножество всех комбинаций.

Например, случайное следование трёх одинаковых букв в слове "длинношеее" казалось бы имеет малую вероятность. (1/32)^3=0,00003 - три стотысячных. Это соизмеримо с величиной, обратной количеству осмысленных слов языка (0.00001). Однако есть слова, например, "обороноспособность", состоящие из 18 букв. Случайная комбинация имеет вероятность 8*10^-28. Таким образом множество осмысленных слов (10^5) меньше множества всех комбинаций 18-буквенных слов (10^28) на 28-5=23 порядка. Напомню, что число Авогадро = 6*10^23, т.е. величина того же порядка. Другими словами, размер множества осмысленных слов языка подобен атому в моле (множестве случайных комбинаций букв).

Я подвожу читателей к осмыслению того факта, что в процессе эволюции на каждом следующем её уровне достигаются всё менее вероятные комбинации элементов для достижения всё более экзотических параметров системы.

Степень экзотики - мера волшебства (С) А.Кушелев


https://img-fotki.yandex.ru/get/173476/158289418.3a9/0_16e47b_387b69ea_orig.jpg



Формы, механизмы, энергия наномира. Сообщение 83 457

Skype, 2016-12-26:

[8:48:39] Andrei: Один профессор, которому я написал, ответил что:
[8:48:46] Andrei: "Unfortunately, my specific expertise is not in protein folding but in docking."
[8:49:36] Andrei: Может ли быть от программы "Пикотехнология" польза для доккинга?
[8:54:38] Andrei: вот например что я нашел про доккинг
[8:54:40] Andrei: http://www.dockingserver.com/web

[8:55:05] Andrei: можно ли такое сделать на базе этой программы и как?
[9:03:46] Andrei: там и бесплатно можно расчет получить для сравнения
[10:38:48] Кушелев Александр Юрьевич: Польза для доккинга конечно. Ведь правильной формы молекулы легко состыкуются smile
[10:39:46] Andrei: ну так этим можно проверить программу?
[10:39:59] Кушелев Александр Юрьевич: Конечно.
[10:40:06] Andrei: как именно
[10:40:21] Кушелев Александр Юрьевич: Если автоматически состыкуются белки, значит правильно сделаны
[10:40:34] Andrei: доккинг это состыковка белков?
[10:42:58] Andrei: ага
[10:43:03] Andrei: https://ru.wikipedia.org/wiki/%D0%9C%D0 … 0%BD%D0%B3



Формы, механизмы, энергия наномира. Сообщение 83 484

Самоповерка пикотехнологии

Денис пишет:

Если вероятность одного из 4 кодов одинакова, то вероятность комбинации 1111111111111111111111 такая же как 1212121212121212121212, 2212331223213113113233, 3444134142143324442111 или любой другой комбинации с одинаковым количеством вариантов.

Кушелев: Совершенно верно! И одна из 2^44 комбинаций будет 1111111111111111111111

Но если Вы внимательно посмотрите на композиционные коды белков, то комбинация 1111111111111111111111 встретилась уже дважды, хотя я проверил всего несколько десятков белков. А это значит, что среди 2^44 белков попадётся не менее(!) 2^41 структур с последовательностью 1111111111111111111111

Как видите реальная частота выше случайной в 2^41 раз smile




Композиционный генетический код, открытие 1992 года

Композиционный генетический код в действии

http://img-fotki.yandex.ru/get/5106/nanoworld.205/0_48908_9fa5c119_S.gif





Пикотехнологические модели четвертичной структуры гистонов.


http://img-fotki.yandex.ru/get/6001/nanoworld.204/0_48888_9c8642fd_orig.pnghttp://img-fotki.yandex.ru/get/5701/nanoworld.204/0_4888b_d09d413c_orig.png






Семиричная симметрия шаперонов.



http://img-fotki.yandex.ru/get/4806/nanoworld.209/0_48a81_60553002_L.pnghttp://img-fotki.yandex.ru/get/5601/nanoworld.209/0_48ac9_5caf538b_L.png

http://img-fotki.yandex.ru/get/4402/nanoworld.209/0_48a02_8b0a1fc2_L.pnghttp://img-fotki.yandex.ru/get/5600/nanoworld.209/0_48ace_e83a1594_L.png








https://www.nulled.cc/threads/239379/

Александр Кушелев: Ко мне сегодня зашел инвестор, дал 1000 долларов и сказал: Если через неделю сможешь из 1000 долларов сделать 10 000, то я тебе дам миллион. А если не сможешь, то больше не дам ничего. Я его спрашиваю, а если 1000 долларов пропадёт, возвращать надо? Он сказал, что не надо. Я так думаю, что 10 000 долларов из 1000 за неделю сделать нереально, поэтому лучше организовать лотерею. Я отдам эти 1000 долларов случайному человеку сделавшему репост этого сообщения. И не потому что мне не нужны деньги. Просто 1000 долларов для меня погоды не сделает, а ваши репосты дадут мне ... нет, не 10 000 долларов за неделю. Это нереально. Зато позже ваши репосты дадут мне доход от 10 000 долл. в день. Я не боюсь рассказать, как это получится. Дело в том, что это может получиться только у меня. В 1992-ом году я сделал научное открытие, открыл композиционный генетический код. Он отличается от обычного тем, что кодирует не только аминокислоты, но и углы поворота между ними. Казалось бы мелочь, но это позволяет по коду мгновенно определить структуру белка. А пока на определение одной структуры белка уходит до 3 месяцев работы лаборатории рентгеноструктурного анализа. Причём точность новой технологии в ~1000 раз выше. Рентгеном можно определять структуру только кристаллов, а ~97% белков не кристаллизуются. Т.е. моё открытие в 30 раз превосходит рентген! Все лаборатории планеты за один день могут определить 20-30 структур. Моё научное открытие позволяет мне одному определять до 100 структур в день. Это значит, что я могу ежедневно выполнять заказы на миллион евро. Тысячи репостов моего сообщения помогут найти менеджеров, которые будут находить заказы на структуры белка. Мне не жаль отдать им 60% с каждого заказа, например, 6000 евро из 10 000. На таких условиях будут работать тысячи менеджеров, т.к. обычно менеджерам выплачивают несколько процентов от стоимости крупных заказов. Мне выгодно отдать менеджерам больше половины, т.к. я могу делать до 100 заказов в день, поэтому всё-равно заработаю больше. Менеджеров-то много, а я один Осталось придумать правила лотереи, чтобы всё было законно. Я не хочу иметь неприятности. Кроме того, я не люблю обычные лотереи, в которых один выигрывает, а остальные огорчаются. Ведь в этом случае получается, что лотерея даёт радость одному и горе тысячам. И я придумал, как это исправить. Лотерея будет считаться завершенной, если я получу первый коммерческий заказ на структуру белка. Кому логично отдать 1000 долларов? Самому достойному участнику лотереи. Как его определить? Это уже решать вам. Свои 4000 долларов за первую структуру белка я отдам ещё 4 участникам лотереи. Как их определить? Очень просто. В порядке очереди. Кто первый сделал репост, тот первым и получит 1000 долл. Вместе с ним получат ещё 3 участника согласно очереди. Со последующих заказов структур белка я отдаю на выигрыши половину своей доли, т.е. 6000 - менеджеру, 2000 - мне и 2000 - участникам лотереи. С выполнением каждого заказа свои выигрышы будут получать двое из участников в порядке очереди. Если всего участников будет 1000, то после выполнения 500-го заказа каждый из 1000 участников получит по 1000 долл. Как Вам такая лотерея? Верить на слово мне не обязательно. Можно оформить юридически. А чтобы упростить работу менеджеров я готов первые 100 заказов сделать за свой счет. Для меня это - один день работы


Clyde Bardett: I have got the same !!!!!!!!!!!!!!!!!!!!!!

Александр Кушелев: Autotranslation: To me today went investor, gave $ 1000 and said: If in a week can from $ 1000 to do 10 000, then I'll give you a million. And if you can't, then don't give anything. I asked him, and if $ 1000 to fail, the return must be? He said he did not have. I think that 10 000 dollars from 1000 per week impossible to do, so it's better to organize a lottery. I will give these a $ 1,000 casual man made репост of this message. And it's not because I don't need money. Just $ 1000 for me, the weather does not do, and your репосты will give me ... no, not 10 000 USD for the week. It is unreal. But later your репосты will give me an income of $ 10,000 a day. I'm not afraid to tell the story of how this will work out. The fact that it can happen only to me. In 1992 I made a scientific discovery, opened composite genetic code. It differs from a standard that encodes not only amino acids, but and angles between them. It would seem a trifle, but it allows the code instantly determine the structure of the protein. Meanwhile, the definition of one of protein structure takes up to 3 months the work of the laboratory of x-ray analysis. The accuracy of new technologies in about 1000 times higher. X-ray you can define the structure of only the crystals, and AC 97% of proteins do not crystallize. I.e. my discovery in 30 times greater than the x-ray! All laboratories of the planet in one day can determine 20-30 structures. My scientific discovery allows me to one define up to 100 structures in the day. This means, that I may daily perform orders for one million euros. Thousands of репостов of my posts will help you to find managers who will find orders for protein structure. I'm not sorry to give them 60% with each order, for example, 6,000 euros from 10 000. In such conditions they will work thousands of managers, because it usually managers pay a few percent of the value of major orders. Is it profitable for me to give managers more than half, because I can make up to 100 orders a day, so all the same to earn more. Managers much, and I'm one Remains think of the rules of the lottery, so that everything was legal. I don't want to have troubles. In addition, I do not like conventional lottery, in which one wins, and the rest of the people will be annoyed. In fact, in this case it turns out that the lottery gives joy to one and mount the thousands. And I figured out how to fix it. The draw will be considered completed, if I get the first commercial order for the structure of protein. To whom it is logical to give $ 1000? Most worthy participant of the lottery. How to define it? It is already up to you. Its $ 4000 for the first structure of protein I will give another 4 participants of the lottery. How to define them? Very simply. In turn. Who first made репост, the first and will receive $ 1,000. Together with him will receive 3 more of the participant according to the queue. With subsequent orders structures of protein I give the winnings half of its shares, i.e. 6000 - Manager of the 2 - me and 2 - participants of the lottery. With the execution of each order your prize will receive two of the participants in the line. If all of the participants will be 1000, after the 500-th order each of the 1000 participants will receive $ 1,000. As You are such a lottery? Believe the word I don't have to. Can be issued legally. And in order to simplify the work of the managers I am ready to the first 100 orders to do at his own expense. For me it's one day of work. http://nanoworld.org.ru/topic/461/




http://nanoworld.org.ru/topic/259/page/67/

2012.04.07 13:44:30

Пикотехнология - новый подход в моделировании пространственной структуры белка. Кушелев А.Ю. Соколик В.В.

Текстовый вариант статьи:

ПИКОТЕХНОЛОГИЯ – НОВЫЙ ПОДХОД В МОДЕЛИРОВАНИИ
ПРОСТРАНСТВЕННОЙ СТРУКТУРЫ БЕЛКА

Кушелев А.Ю., Соколик В.В.

Научно-исследовательская лаборатория "Наномир", Дмитров
ГУ «Институт неврологии, психиатрии и наркологии АМНУ», Харьков

В настоящее время наибольшей популярностью пользуются научные исследования с приставкой «нано»: речь идёт об объектах, размер которых лежит в диапазоне 1-100 нанометров [3, с. 28; 16, c. 6]. Однако при моделировании атомов в составе биомолекул возникла необходимость оперировать конфигурацией электронов, формирующих внешний валентный уровень, который и определяет объем, занимаемый тем или иным атомом в пространстве, а это уже размерность пикометров (10-12 м). Пикотехнология, методический подход для моделирования пространственной структуры белка, опирается на следующие представления о микромире:
· кольцегранная структура электронных орбиталей (электронов) в атоме, которая детерминирует в первом приближении форму атома в виде усечённого октаэдра (рис. 1), грани которого – электроны валентного энергетического уровня [17, c. 49; 4, с. 46; 1, с. 73];
· геометрический алгоритм объединения атомов в молекулах определяет не только межатомные расстояния (длины связей), но прежде всего углы поворота по этим связям, кратные 120о в трёхмерном пространстве [2, c. 237; 5, с. 137];
· ротамерный вариант пептидной связи, которая объединяет аминокислотные остатки в полипептид, детерминирован третьим нуклеотидом кодона [2, c. 237; 18, c. 347] и реализуется в ходе матричного синтеза структурного шаблона белка на рибосоме пулом изоакцепторных тРНК [6, c. 13].

http://img-fotki.yandex.ru/get/6102/70695945.a/0_890e3_53b79798_orig
А Б


Рис. 1. Кольцегранная модель валентной электронной оболочки атома из 8 электронов (А) и её аппроксимация усеченным октаэдром (Б) в моделях белков.

Десять лет назад А.Ю. Кушелевым была сформулирована идея композиционного генетического кода [2, c. 237], которая была расширена представлениями о кодировании ротамерии пептидной связи и структурного шаблона белка [18, c. 348; 19, с. 275; 20, c. 118]. В таблице композиционного генетического кода каждому варианту композиционного кода, в зависимости от кодона, соответствовало определённое значение композиционного угла, под которым в ходе матричного синтеза происходит присоединение очередного аминокислотного остатка к растущей полипептидной цепи. Данная таблица легла в основу алгоритма первого варианта компьютерной программы «Пикотехнология» для моделирования пространственной структуры белка по детерминирующей его нуклеотидной последовательности. Дальнейшая разработка данной проблемы привела к уточнению не только самой таблицы, но и к введению таких понятий, как ротамерия пептидной связи и структурный шаблон белка. Было установлено, что в геноме третьим нуклеотидом кодона детерминирован один из трёх ротамерных вариантов пептидной связи, которым аминокислотный остаток (закодированный дуплетом первых двух нуклеотидом кодона) присоединяется к растущей полипептидной цепи (табл. 1).

Таблица 1. Генетический код структурного шаблона белка

http://img-fotki.yandex.ru/get/6103/70695945.b/0_890f9_e1ebecbf_orig.png

XYZ – первый, второй и третий нуклеотиды в кодоне; R, 0, L – ротамерные варианты пептидной связи (РВПС); uaa, uag, uga – Stop-кодоны.

Ротамерные варианты пептидной связи различаются между собой углом поворота по оси пептидной связи ?, кратным 120о. Крайне важно понимать, что ротамерный вариант пептидной связи реализуется в процессе синтеза белка в рибосоме и дальнейшее вращение по уже образовавшейся полуторной пептидной связи становиться невозможным. Поэтому с рибосомы сходит совершенно индивидуальный структурный шаблон белка из последовательности ротамерных вариантов пептидной связи, в соответствие с информацией, содержащейся в его гене. Именно этим обстоятельством мы объясняем невозможность синтезировать нематричным способом функционально активные большие молекулы белковых ферментов или рецепторов. Твердофазный синтез реализован только для небольших неструктурированных пептидов, которые характеризуются избыточной конформационной подвижностью, в силу чего их функциональные конформации определяются взаимодействием с белками-партнёрами в составе гетерокомплексов, а не индивидуальным структурным шаблоном [13, с. 38].
Для конформеров вторичной структуры белка характерна периодичность, поэтому, правая спираль в структурном шаблоне белка кодируется последовательностью кодонов с С/G в третьей позиции, ?-тяж – повторением кодонов с А, а левая спираль – последовательностью кодонов с Т в третьем положении (табл. 2). Неструктурированные фрагменты кодируются чередованием кодонов с С/G, А и Т в третьей позиции.

Таблица 2. Кодирование конформеров вторичной структуры белка

http://img-fotki.yandex.ru/get/6203/70695945.b/0_8910c_165eeea6_orig.png

У R, 0 и L-ротамеров все атомы пептидной группы (C? (i), C (i), O (i), N (i+1) H (i+1)) компланарны, кроме C? (i+1). C? (i+1) атом каждого аминокислотного остатка не принадлежит плоскости пептидной группы, благодаря чему происходит сворачивание полипептидной цепи в конформеры вторичной структуры белка (правая ?-спираль, ?-тяж, левая 3/10-спираль) ещё в рибосоме (рис. 2), а не после синтеза полипептидной цепи из практически единственного транс-изомера (цис-изомер только у пролина) в виде плоской ленты, сворачивание которой достигается поворотами на углы ? и ? по связям СО—C? и NH—C?, как предполагали ранее [9, с. 134]. Пластичность структурного шаблона в ходе посттрансляционного фолдинга и конформационная подвижность белка при взаимодействии с лигандами достигаются единственно возможным поворотом по оси связи NH—C? на приращение угла ?, кратное 120о [5, с. 139].

http://img-fotki.yandex.ru/get/6202/70695945.b/0_89113_23e58edc_orig.png

Рис. 2. Схема образования правого (R), нулевого (0) и левого (L) ротамерных вариантов пептидной связи.

Данный механизм трансляции генетической информации является эволюционно новым. Его формирование у эукариот было обусловлено необходимостью синтеза больших и сложных белков в виде структурного шаблона, максимально приближенного к функциональной конформации этих белков, чтобы их фолдинг имел наибольшие скорость и КПД. У прокариот и органелл эукариот (митохондрии, хлоропласты) третий нуклеотид кодонов в генах небольших полипептидов ещё не является информационным, поэтому на нём и наблюдается воблирование по описанному Ф. Криком механизму [12, с. 368]. Это обусловлено отсутствием пула изоакцепторных тРНК с модифицированными нуклеотидами в первом положении антикодона [6, с. 11] и нередко отсутствием филогенетически более молодых областей в структуре тРНК [15, с. 6730], т.е. недоразвитием звена, реализующего информацию третьего нуклеотида.
Выше изложенные положения легли в основу алгоритма компьютерных программ Secondary Structure Protein (SSP) и Three-dimension Structure Protein (TSP), которые по нуклеотидной последовательности мРНК позволяют смоделировать схему вторичной структуры и визуализировать индивидуальный структурный шаблон любого белка. Эту первичную информацию о белке можно использовать в дальнейшем моделировании фолдинга функциональной конформации белка с учетом физ-химии его микроокружения, посттрансляционных модификаций, взаимодействия с лигандами методами молекулярной динамики наравне с информацией о наиболее стабильном конформере, которую извлекают из рентгенограмм кристаллов белков. Преимущество данного подхода состоит в возможности быстрого моделирования индивидуальной пространственной структуры отдельной молекулы любого белка (даже если он не кристаллизуется, и никогда не сворачивается, как, например, регулятор клеточного деления Sic1 [11, с. 152]) с точностью до электрона (пикотехнология), опираясь лишь на информацию о нём в геноме. То есть, мы in silico воспроизводим трансляцию генетической информации в индивидуальный структурный шаблон белка, а не занимаемся поиском самой стабильной или «быстро достигаемой» устойчивой его конформации из 10100 возможных [14, с. 44], как это происходит при конформационном анализе поверхности потенциальной энергии молекулы белка громоздкими методами систематического поиска, Монте-Карло или молекулярной динамики с целым рядом ограничений и приближений [10, с. 41]. Не исключено, что большинство белков именно из конформации своего структурного шаблона максимально быстро, а главное однозначно, фолдируют в нативную конформацию с минимумом свободной энергии, формируя, таким образом, «устойчивое большинство» конформационно лабильного белкового пула.


http://img-fotki.yandex.ru/get/6101/70695945.b/0_891b5_7fecab51_orig.png


Рис. 3. Пикотехнологические модели структурных шаблонов некоторых белков и их комплексов.
В последнее время А.С. Спирин, отклоняясь от постулата о матричном синтезе белка в виде развёрнутой полипептидной цепочки [7, с. 5], предположил, что в самой рибосоме полипептид синтезируется сразу в виде ?-спирали и по желобу выталкивается наружу по мере трансляции мРНК [8, с. 437]. Этой прогрессивной гипотезе, которая основывается на подавляющем (74%) большинстве «спиральных» кодонов в генах эукариот, остался один шаг до представления о трансляции структурного шаблона белка не только в виде ?-спирали.
С помощью пикотехнологии были декодированы и смоделированы структурные шаблоны более 100 белков (рис. 3), сопоставительный анализ которых с экспериментальными данными Protein Data Bank (PDB) позволил подтвердить предположение о генетически закодированных размерах и местоположении конформеров вторичной структуры в нативной конформации этих белков [18, c. 348].
Итак, пикотехнология – это современный, точный и удобный методологический подход в арсенале молекулярной биологии для моделирования пространственной структуры белков, исходя из той информации генома о них, которой располагает сама клетка.


Список литературы


1. Кушелев А., Полищук С., Писаржевский С. Формы, механизмы, энергия наномира: Доступна ли энергия эфира для космических полётов? // Электроника: Наука, Технология, Бизнес. – 2002. – № 6. – С.72–76.
2. Кушелев А.Ю., Полищук С.Е., Неделько Е.В. и др. Построение масштабной модели структуры белка // Актуальные проблемы современной науки. – 2002. – № 2. – С. 236–243.
3. Нанонаука и нанотехнологии: энциклопедия систем жизнеобеспечения / Моск. гос. техн. ун-т им. Н. Э. Баумана; ред. О. О. Аваделькарим; гл. ред.: Чуньли Бай, С. П. Капица. — М.: Магистр-Пресс : Изд-во ЮНЕСКО : EOLSS, 2009. — 991 с.
4. Огжевальский З.И. 1972. Пространственные модели атомов, молекул и кристаллов. Москва, 1972. – 118 c.
5. Соколик В.В. Карта Рамачандрана: ротамерия пептидной связи и фолдинг белка // VII Международная научно-техническая конференция «Актуальный вопросы биологической физики и химии». БФФХ-2011, Севастополь. – 2011. – С.137–139.
6. Соколик В.В. Загадка изоакцепторных тРНК // II Всероссийская Интернет-Конференция «Актуальные проблемы биохимии и бионанотехнологии», Казань. – 2011. – С. 11-15.
7. Спирин А.С. Биосинтез белка: элонгация полипептида и терминация трансляции // Соросовский образовательный журнал. – 1999. – № 6. – С. 2–7.
8. Спирин А.С. Молекулярная биология: рибосомы и синтез белка. – М: «Академия», 2011. – 496 с.
9. Финкельштейн А.В., Птицын О.Б. Физика белка. - М.: Книжный дом «Университет», 2002. – 298 с.
10. Хёльтье Х.-Д., Зиппль В., Роньян Д., Фолькерс Г. Молекулярное моделирование. М.: БИНОМ. Лаборатория знаний, 2010. – 320 с.
11. Chouard T. Structural biology: Breaking the protein rules // Nature. – 2011. – V. 471, № 7337. – P. 151–153.
12. Crick F.H.C. The Origin of the Genetic Code // J. Mol. Biol. – 1968. – V. 38. – P. 367–379.
13. Fink A.L. Natively unfolded proteins // Curr. Opin. Struct. Biol. – 2005. – V.14, № 1. – P. 35-41.
14. Levinthal C. Are there pathways for protein folding // J. Chim. Phys. – 1968. – V. 65. – P. 44–45.
15. Maizels N., Weiner A.M. Phylogeny from function: Evidence from the molecular fossil record that tRNA originated in replication, not translation. // Proc.Nat.Acad.Sci.USA. – 1994. – V. 91, № 15. – P. 6729–6734.
16. Ratner M., Ratner D. Nanotechnology: a gentle introduction to the next big idea, 2003. – 195 p.
17. Snelson K. A design for the atom // Industrial design. – 1963. – № 1. – P. 48–57.
18. Sokolik V.V. Protein is coded in genome and synthesized in ribosomes as a structural template of a rotameric version sequence of peptide bound configuration // The International Moscow Conference on Computational Molecular Biology, МССМВ-11, Moscow. – 2011. – P. 347–348.
19. Sokolik V.V. Modeling of the individual structural template of protein on determining it nucleotide sequences // VII Международная конференция по биоинформатике, регуляции и структуры геномов и системной биологии. BGRS\SB-2010, Новосибирск. – 2010. – С. 275.
20. Sokolik V.V. Algorithm of protein structural template decoding according to its determined nucleotide sequence // Fist International Conference “Fundamental medicine: From scalpel toward Genome, Proteome and Lipidome”, Pax Grid Virtual Conferences, Kazan. – 2011. – P. 117–119.


Подписи под иллюстрациями.


Рис. 3: Гистоновый комплекс 5 H2A + Н2В_DROME (P84051, P02283)
Шаперон A0KFQ4_AERHH (A0KFQ4)
Суперспираль коллагена CO2A1_HUMAN (Р02458)
Белковый комплекс ?-протеина с ?-тубулином TAU_HUMAN + TBA1A_HUMAN
Инсулин INS_HUMAN (Р01308)
Лизоцим LYSC_CHICK (P00698)
Рибонуклеаза Н1 RNH_ECOLI (P0A7Y4)
Аполипопротеин Е APOE_HUMAN (P02649)
Гемоглобин (А-цепь) HBA_HUMAN (P69905)





http://img-fotki.yandex.ru/get/5502/nanoworld.202/0_4840b_b2101c2f_orig.gif