Перевести страницу

Классическая волновая физика радиоэфира Фарадея-Максвелла

Рубиновая энергетика и эфироопорные двигатели

Пикотехнология белков

Биотехнология вечной молодости

Исследования мегалитов

Инопланетная инженерия




Определены структуры всех белков человека



ПИКОТЕХНОЛОГИЯ БЕЛКОВ ДАЙДЖЕСТ


660 выпуск рассылки


Определены структуры всех белков человека


   


На базе научного открытия нами создан онлайн-сервис по определению структуры белковых молекул. Теперь мы сможем зарабатывать вместе.


По старой технологии определение одной структуры белка обходится примерно в 10 000 евро, а ждать нужно от 2 месяцев до 3 лет. По новой технологии структура определяется в 1000 раз точнее и в миллиард раз быстрее. 80% от найденного Вами заказа принадлежат Вам, как менеджеру.


Наш лозунг: "В 1000 раз лучше, в 1000^3 быстрее и в 1000 раз дешевле!"


Ваша задача заключается в размещении рекламы на онлайн-сервис белковых структур. Рынок этих структур очень большой и продолжает стремительно расти. Ежедневно кто-то оплачивает до 60 структур по средней цене 10 000 евро за штуку. Новая технология позволила на одном персональном компьютере за неделю определить структуры всех 115 000 белков человека, для которых известна нуклеотидная кодирующая последовательность. При этом качество результата, полученного по новой технологии в 1000 раз выше по точности, в миллиард раз по быстродействию и в 30 раз шире по номенклатуре белковых молекул. Единственное, что нам сегодня не хватает - рекламы.


Как получить Вашу первую зарплату менеджера? Найти заказчика белковых структур  и убедить его заказать за счёт лаборатории Наномир пробный заказ. Когда заказчик распробует новую технологию, он начнёт делать коммерческие заказы. С первого коммерческого заказа менеджер получает 80%. С последующих заказов процент будет постепенно уменьшаться, но с первого заказа другого заказчика менеджер снова получит 80%. Зарплата менеджера может достичь миллиона евро в день. И это не предел.


https://img-fotki.yandex.ru/get/107080/158289418.3c1/0_1705b1_dc9f55fd_M.gif https://img-fotki.yandex.ru/get/169883/158289418.3b3/0_16f622_63ae0418_M.gif

Фрагменты моделей белков, замкнувшихся через дисульфидные мостики в процессе автоматической сборки по таблице композиционного генетического кода.

https://img-fotki.yandex.ru/get/371487/158289418.4bc/0_18a588_ce47e849_orig.gif


"Монстр" первой хромосомы человека насчитывает 5207 аминокислотных остатков.

Вторичные структуры белков в компантном изображении: 



 


Первая 1000 белковых структур за счёт лаборатории Наномир (по старой технологии это стоило бы 10 миллионов евро). 

Обсуждение



Найден материал для включения источника энергии ударом!

660 выпуск рассылки


Найден материал для включения источника энергии ударом!


https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcRjtf-DgWf_n8hGF3UmM9lsSX9iOrGiCUzgqsO37_YlB5_u0G47lg

Структура танталата калия 

Цитата:  Танталат калия обладает уникальным свойством - его диэлектрические потери уменьшаются при понижении температуры, достигая значения 3,610-5 при 4,2 К на частоте 13,6 ГГц [23]. 

Конец цитаты.

Материал с форума лаборатории Наномир: 

Кушелев: Это уже совсем интересно...

Дело в том, что танталат калия - сегнетоэлектрик, т.е. по существу он может подойти для включения источника энергии ударом, хотя и при температуре жидкого гелия.

Если мы включим ударом источник энергии из танталата калия, то от него можно будет включить рубиновый источник, настроенный на ту же частоту. Это может оказаться проще, чем включать источник энергии от импульсного магнетрона...

По крайней мере после включения источника энергии при температуре 4.2 К энтузиазм инвесторов просто зашкалит, и они точно найдут денег для ускорения включения рубинового источника энергии "от чего угодно" smile

[0:06:45] mihel-mouse: Так это же при температурах близких к абсолютному нулю((((( При н.у. не заработает же или Вы охлаждать жидким гелием собираетесь?

[0:08:27] Кушелев Александр Юрьевич: А что такого? Может и жидкого азота хватит smile
[0:08:40] Кушелев Александр Юрьевич: А жидким азотом я в летней лаборатории сапфир охлаждал...
[0:09:40] mihel-mouse: Может и хватит, а может и нет, данные бы по зависимости диэлектрических потерь от температуры знать))
[0:09:47] Кушелев Александр Юрьевич: Добротность резонатора, имеющего форму эллипсоида, может быть существенно меньше 50 000. Может быть и 10 000 хватит smile
[0:10:06] Кушелев Александр Юрьевич: Данные найдём...
[0:10:41] Кушелев Александр Юрьевич: Если охлаждённый включится, то инвесторы продадут всё ненужное, чтобы только скорее рубиновый включить.

Цитата:
Рабочая частота   9,6 ГГц 
Магнитное поле   0 – 3500 Гс 
Частота модуляции   100 кГц 
Резонатор сегнетоэлектрический:  
Тип колебания  ТЕ01δ 
Добротность  1000 - 5000

Конец цитаты

Кушелев: При комнатной температуре добротность доходит до 5000. Понятно, что в жидком азоте она перевалит за 10 000, что вполне может хватить для включения источника энергии, имеющего форму эллипсоида. 

[0:15:23] Кушелев Александр Юрьевич: Диэлектрические потери (295 К)  10^3-10^4 Постоянная Кюри-Вейсса   (6±2)10^4 К
[0:29:43] mihel-mouse: А.Ю., теперь, как я понимаю, Вам осталось найти ту лабораторию которая правильно изготовит Вам брусочек из прессованного KTaO3, да ещё и умудрится его поляризовать или Вы нашли уже где купить его уже в виде пьезокерамики?

Кушелев: Сравнительные характеристики сапфир / танталат калия

Материал, Диаметры:

экран внешний-внутренний, мм-мм-мм 
Высота, мм, Частота, MГц, Вес, кг, Источник

Al2O3 112-71.2-45.5 240 1580        [45, 46] 

KTaO3 71.2-70.4       240 1334 1.49 [47] 

Электронное строение тантала:

 

211321882

 

Согласно химической формуле танталата калия KТаO3, тантал проявляет в этом соединении валентность 6-1=5

Если же посмотреть на структурную схему кристаллической ячейки, то

https://encrypted-tbn0.gstatic.com/images?q=tbn:ANd9GcRjtf-DgWf_n8hGF3UmM9lsSX9iOrGiCUzgqsO37_YlB5_u0G47lg

находящийся в центре тантал отдает 6 электронов окружающим атомам кислорода, и получает 1 электрон от находящегося в вершине куба атома кальция. Валентность та же, +5.

На внешней оболочке тантала находится 2 электрона, а ещё 3 он отдает с предвнешней, на которой остается 11-3=8.

Понятно, что эти 8 электронов ориентированы нормалями по направлению из ядра тантала к вершинам кубической ячейки.

Зазоры в октаэдрических вершинах заполняют электроны окружающих атомов кислорода. В результате получается устойчивый электронный каркас танталата калия.

Нужно будет сделать пикотехнологическую модель танталата калия в программе 3DS Max. 


 










Зеленым цветом показаны валентные электроны предвнешней оболочки тантала.


Они образуют общую электронную структуру с достроенной внешней оболочкой атомов кислорода (показаны голубым цветом), расположенных в центрах граней куба. Ближний ион кислорода из 6 не показан, чтобы было лучше видно валентные электроны тантала.

 

Вид через центр отсутствующего иона кислорода. Красным цветом показаны ионы калия, расположенные в вершинах куба.

 

Вид на элементарную ячейку кристалла KTaO3 со стороны отсутствующего иона кислорода

 

Вид на элементарную ячейку кристалла KTaO3 с противоположной стороны

  

Вид вдоль диагонали куба (крупный план)

 

Вид вдоль диагонали куба (общий план) 




Похоже, что ядро тантала со всеми оболочками, кроме предвнешней (она же валентная), может находиться в одном из локальных минимумов энергии, которых, судя по расположению валентных электронов тантала может быть, например, 6. Это и лежит в основе поляризуемости кристалла KTaO3, т.е. в основе сегнетоэлектрических свойств. 


Скрипт, по которому построена пикотехнологическая модель танталата калия в программе 3DS Max:

-- KTaO3. Picotech model
--Nanoworld Laboratory. Alexander Kushelev.
--http://nanoworld.narod.ru
--http://nanoworld.org.ru
--
-- K (red) 8 ions
m = torus radius1:11 radius2:1.1 segs:20 sides:12 position:[0,0,0] wirecolor:[255,0,0]
select m; converttomesh selection
rotate m 90 [0,1,0]; move m [16.5, 0, 0]; m.pivot = [0,0,0]; rotate m -35.27 [0,1,0]; rotate m 45 [0,0,1]
m1 = instance m wirecolor:[255,0,0]; rotate m1 90 [0,0,1]
m2 = instance m1 wirecolor:[0,0,255]; rotate m2 90 [0,0,1]
m3 = instance m2 wirecolor:[255,0,0]; rotate m3 90 [0,0,1]
m4 = instance m3 wirecolor:[0,0,255]; rotate m4 90 [1,0,0]
m5 = instance m4 wirecolor:[255,0,0]; rotate m5 90 [0,0,1]
m6 = instance m5 wirecolor:[0,0,255]; rotate m6 90 [0,0,1]
m7 = instance m6 wirecolor:[255,0,0]; rotate m7 90 [0,0,1]
attach m m1; attach m2 m3; attach m4 m5; attach m6 m7
attach m m2; attach m4 m6; attach m m4
dia = 30; move m [dia, dia, dia]
c1 = instance m wirecolor:[255,0,0]; c1.pivot = [0,0,0]; rotate c1 90 [0,0,1]
c2 = instance c1 wirecolor:[255,0,0]; c2.pivot = [0,0,0]; rotate c2 90 [0,0,1]
c3 = instance c2 wirecolor:[255,0,0]; c3.pivot = [0,0,0]; rotate c3 90 [0,0,1]
c4 = instance c3 wirecolor:[255,0,0]; c4.pivot = [0,0,0]; rotate c4 90 [0,1,0]
c5 = instance c4 wirecolor:[255,0,0]; c5.pivot = [0,0,0]; rotate c5 90 [0,0,1]
c6 = instance c5 wirecolor:[255,0,0]; c6.pivot = [0,0,0]; rotate c6 90 [0,0,1]
c7 = instance c6 wirecolor:[255,0,0]; c7.pivot = [0,0,0]; rotate c7 90 [0,0,1]
--
-- O (blue) 6 ions
mm = torus radius1:11 radius2:1 segs:20 sides:12 position:[0,0,0] wirecolor:[0,0,255]
select mm; converttomesh selection
rotate mm 90 [0,1,0]; move mm [17, 0, 0]; mm.pivot = [0,0,0]; rotate mm -35.27 [0,1,0]; rotate mm 45 [0,0,1]
mm1 = instance mm wirecolor:[0,0,255]; rotate mm1 90 [0,0,1]
mm2 = instance mm1 wirecolor:[0,0,255]; rotate mm2 90 [0,0,1]
mm3 = instance mm2 wirecolor:[0,0,255]; rotate mm3 90 [0,0,1]
mm4 = instance mm3 wirecolor:[0,0,255]; rotate mm4 90 [1,0,0]
mm5 = instance mm4 wirecolor:[0,0,255]; rotate mm5 90 [0,0,1]
mm6 = instance mm5 wirecolor:[0,0,255]; rotate mm6 90 [0,0,1]
mm7 = instance mm6 wirecolor:[0,0,255]; rotate mm7 90 [0,0,1]
attach mm mm1; attach mm2 mm3; attach mm4 mm5; attach mm6 mm7
attach mm mm2; attach mm4 mm6; attach mm mm4
dia2 = 30; move mm [dia, 0, 0]
cc1 = instance mm wirecolor:[0,0,255]; cc1.pivot = [0,0,0]; rotate cc1 90 [0,0,1]
cc2 = instance cc1 wirecolor:[0,0,255]; cc2.pivot = [0,0,0]; rotate cc2 90 [0,0,1]
cc3 = instance cc2 wirecolor:[0,0,255]; cc3.pivot = [0,0,0]; rotate cc3 90 [0,0,1]
cc4 = instance cc3 wirecolor:[0,0,255]; cc4.pivot = [0,0,0]; rotate cc4 90 [1,0,0]
--
-- Ta (green)
t = torus radius1:4 radius2:0.5 segs:20 sides:12 position:[0,0,0] wirecolor:[0,255,0]
select t; converttomesh selection
rotate t 90 [0,1,0]; move t [12, 0, 0]; t.pivot = [0,0,0]; rotate t -35.27 [0,1,0]; rotate t 45 [0,0,1]
t1 = instance t wirecolor:[0,255,0]; rotate t1 90 [0,0,1]
t2 = instance t1 wirecolor:[0,255,0]; rotate t2 90 [0,0,1]
t3 = instance t2 wirecolor:[0,255,0]; rotate t3 90 [0,0,1]
t4 = instance t3 wirecolor:[0,255,0]; rotate t4 90 [1,0,0]
t5 = instance t4 wirecolor:[0,255,0]; rotate t5 90 [0,0,1]
t6 = instance t5 wirecolor:[0,255,0]; rotate t6 90 [0,0,1]
t7 = instance t6 wirecolor:[0,255,0]; rotate t7 90 [0,0,1] 

[20:43:59] Потенциальный инвестор: То есть 5000 долл хватит на запуск?
[21:16:25] Кушелев Александр Юрьевич: Будем надеяться. Гарантию заранее не даст даже Бог smile
[21:26:58] Кушелев Александр Юрьевич: 5000 долл. позволит реализовать два проекта. И пьезо-керамический, и с магнетроном. Но с магнетроном хоть и надежнее, но по-хорошему нужно заказывать номинальный ряд рубиновых резонаторов. У меня в настоящее время есть только несколько небольших участков номинального ряда. Причём некоторые участки перекрыты шариками, а некоторые - эллипсоидами:

https://img-fotki.yandex.ru/get/9822/158289418.200/0_123aee_b1f62d17_XL.jpg

[12:36:03] Главный инвестор alg: поле электромагнитное ?
[12:36:40] Кушелев Александр Юрьевич: Да. Поле электромагнитное. Для частоты 2.45 ГГц диаметр эллипсоида типа 35 мм
[12:37:04] Кушелев Александр Юрьевич: В рассылке были опубликованы данные для эллипсоида.
[12:37:29] Кушелев Александр Юрьевич: Просто я пока не смог экспериментально обнаружить рабочую моду, которая смоделирована в HFSS
[12:37:56] Кушелев Александр Юрьевич: Инвестор D смоделирует процесс возбуждения, и тогда я смогу экспериментально найти эту моду.
[12:39:54] Главный инвестор alg: и последний вопрос как в диэлектрическом не магнитном  шарике образуется электрическое и магнитное поле
[12:41:13] Кушелев Александр Юрьевич: В проводниках возможен ток проводимости, а в диэлектриках - ток смещения. Когда связанные заряды колеблются относительно положения равновесия.
[12:41:50] Кушелев Александр Юрьевич: Поэтому существуют не только проводящие, но и диэлектрические резонаторы и волноводы. Гугл знает smile
[12:42:04] Главный инвестор alg: это и есть та радиоволна которая закачивается в шарик , а шарик как лазер её усиливает и не отпускает и только часть энергии вылазит из шарика на 0,5 см ?
[12:43:05] Кушелев Александр Юрьевич: Волны - это процесс распространения колебаний в среде. В данном диэлектрическом резонаторе таких волн нет. Есть стоячие волны, когда колебания сосредоточены в небольшой области.
[12:43:14] Кушелев Александр Юрьевич: А процесс преобразования энергии такой же, как в дребезжащем редукторе.
[12:43:49] Кушелев Александр Юрьевич: Часть энергии вращения "шестеренок Максвелла" преобразуется в энергию колебаний тех же "шестеренок Максвелла", т.е. в электромагнитные колебания.
[12:44:11] Кушелев Александр Юрьевич: А процесс возбуждения можно посмотреть на модели в программе HFSS:
[12:44:26] Главный инвестор alg: спасибо
[12:46:11] Кушелев Александр Юрьевич:

 

https://img-fotki.yandex.ru/get/46165/158289418.286/0_1477be_833a0bd0_XL.gif[12:46:36] Кушелев Александр Юрьевич: Справа видны более длинные волны в воздухе (проводящий волновод)
[12:46:50] Кушелев Александр Юрьевич: В середине волны короче (диэлектрический волновод)
[12:47:09] Кушелев Александр Юрьевич: А слева резонансная система из рубиновых шариков
[12:47:41] Кушелев Александр Юрьевич: Другой ракурс:

 

 

https://img-fotki.yandex.ru/get/65449/158289418.285/0_146cb0_c246ec23_XL.gif[12:48:38] Кушелев Александр Юрьевич: Крупно один шарик:

 

https://img-fotki.yandex.ru/get/105980/158289418.356/0_16114d_b5936913_XL.gif

[12:50:48] Кушелев Александр Юрьевич: Подробнее: http://nanoworld.org.ru/topic/727/ 

 Подробнее 

 Обсуждение

Нужно ехать на оборонный завод включать рубиновый источник энергии от магнетрона, от которого уже дважды засветили один рубиновый шарик.



    https://img-fotki.yandex.ru/get/894110/249950893.1/0_16b0ae_17f1ba0f_orig.jpg

    https://img-fotki.yandex.ru/get/878955/249950893.0/0_165798_303d9f78_orig.png



    http://nanoworld.org.ru/post/96421/#p96421
    1. Предполагаемые габаритные размеры: 0.3*0.3*0.03 м на 1 тонну силы.
    2. Способы крепления установки к корпусу: Стандартные, т.е. такие же, как у реактивного двигателя.
    3. Тип топлива: Топливо отсутствует. Ruby Emdrive - бестопливный двигатель.
    4. Энергоэфективность - столько тонн может поднимать. При массе двигателя 1 кГ подъёмная сила около тонны. Зависимость линейная, т.е. на каждую тонну силы нужно 1 кГ массы двигателя.
    5. В каких средах работает: В космосе, в атмосфере, под водой и под землёй.
    6. Ресурс двигателя: Не ограничен.
    7. Предельные режимы работы: Ускорение не более 10 000 "жэ". Температура не более 2000 градусов.
    8. Максимальная скорость и ускорение летательного аппарта весом 45 тн: Рекомендуемая скорость в атмосфере - две скорости звука. Максимальная скорость - вторая космическая. В космосе максимальная скорость 99% от скорости света.




    http://nanoworld.org.ru/post/95658/#p95658
    Формы, механизмы, энергия наномира » Putin's Ruby Emdrive
    https://www.facebook.com/permalink.php? … 2351452961
    Кушелев: Как изготавливаются рубиновые источники энергии, рассчитанные на 300 киловатт (для легкового автомобиля). Это было 2 года назад, а ... "наука не стоит на месте":
    http://nanoworld.org.ru/topic/1707/
    Виктор Месогиос: Их удалось запустить-таки?
    Александр Кушелев: Пока что удалось проверить защиту элементов. Сначала в Дубне в 2011 году от ускорителя мощностью 100 мегаватт, а в 2016-ом и 2017-ом годах удалось повторить эксперимент со свечением одного рубинового шарика от импульсного магнетрона на уровне мощности 7 кВт. Так что теперь задача упростилась, а проект удешевился в тысячи раз. Сейчас собираю средства на командировку. Нужно ехать на оборонный завод включать рубиновый источник энергии от магнетрона, от которого уже дважды засветили один рубиновый шарик.
    Виктор Месогиос: а какое время он в 16-17 светился? до нагрева дело дошло?
    Александр Кушелев: Время свечения в 2016-ом году было более 10 секунд, а яркость оценивалась как 15-ваттная лампа накаливания.
    Александр Кушелев: Добротность рубинового резонатора ~50 000, поэтому он сбрасывает лишнюю энергию исключительно в оптическом диапазоне. Он может сам нагреться не более, чем на 1 градус.
    Пока инвесторы собирают по крохам средства на мою командировку (уже третий месяц), я определил по новой технологии более 500 белковых структур: http://nanoworld.org.ru/topic/1699/
    Самым предприимчивым пикотехнология белков принесет триллионы долларов. Если удастся привлечь клиентов, чтобы они сделали пробные заказы за мой счет, то новая технология очень быстро распространится по планете. Ведь старая технология (рентгеноструктурный анализ) не может определить структуры 97% белков даже по триллиону долларов за штуку. А новая может и первые 100 заказов даром smile
    ***
    Виктор Месогиос: то есть свечение продолжалось "в автономном режиме"?
    Александр Кушелев: Учитывая, что скважность сигнала от магнетрона была 3000, импульсная мощность свечения была на уровне 1.5 кВт.
    Александр Кушелев: Нет, это был режим периодического возбуждения резонатора от импульсного магнетрона. Проверялась возможность возбудить резонатор до уровня свечения.
    Александр Кушелев: Теперь вместо одного шарика нужно возбудить рубиновый генератор, состоящий из 3...5 шариков. Он уже создаёт условия преобразования внутренней энергии эфира в колебательную форму. Группа шариков будет работать автономно и день включения будет днем создания рубиновой энергетики. После этого новых инвесторов уже не надо. 7 000 000 000 покупателей получат 10-киловаттные источники энергии через 360 деней. Их готова изготовить одна китайская фабрика.

    http://nanoworld.org.ru/post/95719/#p95719
    леонид дегтярев: Нужно уметь убеждать на бумаге для начала, а потом и устно на деле.
    Александр Кушелев: Китайцы уже убедили на деле: http://nanoworld88.narod.ru/data/621.htm
    Александр Кушелев: Это значит, что китайская спецслужба оказалась круче всех остальных...
    леонид дегтярев: Возможно... а где же НАСА ?
    Александр Кушелев: Ушло в подполье smile


    http://nanoworld.org.ru/post/95870/#p95870
    Формы, механизмы, энергия наномира. Сообщение 92 675
    Putin's Ruby Emdrive
    Инвестор P: Инвесторы, видимо, уже засветили группу шариков, только, как это принято в подобных ситуациях, не спешат оглашать сие даже Вам. А иначе зачем инвестору упражняться с одном шариком аж целых пять раз!?!?
    Кушелев: Инвестор SB следит за новостями на форуме лаборатории Наномир. Он прочёл, что мы с Главным инвестором ездили на Завод, где инвестор И один раз засветил рубиновый шарик, а без него там ещё раз его засветили от того же магнетрона, но на другом модуляторе (тоже ламповом).
    И понял, что устойчивое засвечивание одного шарика очень важно. Иначе можно потерять много времени на изготовление групп шариков. Вот он и добился того, что 5 раз засветил шарик в разные дни. После этого он снова вышел на связь и попросил, чтобы я сделал наборы по 5 шариков. 3 набора. Прислал денег на новый станок. Я станок сделал, а на шарики у него пока нет денег. Он их ждёт уже месяц.
    Самое время быстренько сделать модулятор на базе блокинг-генератора. На той самой модуляторной лампе, которая питает на Заводе магнетрон. Она у меня есть. Есть и конденсатор 0.5 микрофарад 25 киловольт. Это в 5 раз больше, чем на Заводе. От такого простого и надежного модулятора мы сможем включить рубиновый источник энергии хоть в домашней лаборатории. Я скоро узнаю, сколько будет стоить работа. 
    Так что есть удачный момент выйти на финишную прямую ...


    http://nanoworld.org.ru/post/95409/#p95409 
    https://img-fotki.yandex.ru/get/480479/249950893.1/0_16b0af_5928fdb2_orig.jpg

    2D и 3D шестеренчатые модели эфира Фарадея Максвелла - догадки независимых авторов. Ждём скорого включение рубинового 'эфирного генератора и эфироопорного двигателя!

    Новости рубиновой / микроволновой энергетики и транспорта

    Почему микроволновой источник энергии - рубиновый генератор - должен включиться   

    Подробно: 12,  3,  4,  5,  6




    Шестерёнчатая 3D  модель эфира Лаборатории Наномир и Фарадея-Максвелла

    В модели Лабораории Наномир эфир состоит из бесконечной кристаллоподобной бесконечной упаковки вращающихся шестерёнок - закольцованных волоновых пакетов, обладающих массой покоя. Макс Планк назвали их Планкионы, Максвелл построил эту модель на полстолетия раньне Планка. Теория автоколебаний, созданная в 20-м веке, моделирует вобблинг шестерёнок, при котором шестерни начинают вибрировать ("дребезжать"), т.е. переходят в режим автоколебаний.   Внутренюю энергию эфира мы можем извлечь или "добыть". Шестерёнки эфира также как мотоцикл переходят в режим вобблинга или автоколебаний, если в некий объём совершить "удар"- направить локальный импульс 1 миллион вольт на метр.  Берём цельный кусок искусственного рубина (корунда) , делаем из него резонатор, направляем в резонатор импульс из магнетрона, происходит накачка, напряжённость растёт до 1 миллиона вольт на метр, шестрени эфира переходят в режим вобблинга,  включается электромагнитное излучение в режиме автоколебаний в виде света -  мы получаем вечную рубиновую лампочку (генератор тепла и света) в режиме автоколебаний.  Эффект свечения резонатора от импульса ускорителя был впервые получен в Дубне в 2011 году. Доступ на ускоритель после этого был закрыт.  В период с 2011 года до настоящее время был разработан номинальный ряд резонаторов, опробованы составные резонаторы и режимы включения от манетрона микроволновой печи и магнетронов мощностью 10/20 кВт.  Весной 2016 года получено свечение сферических составных резонаторов в микроволновой печи.  Осенью 2016 года наблюдались признаки генерации, которая прерывалась по причине пробоя в составных резонаторах. В настоящее время готовятся эксперименты для включения рубинового генератора от магнетрона микроволновки и от магнетронов  мощностью 10/20 кВт. На трёх оборонных заводах собираются экспериментальные стенды с измезряемыми параметрами .


         Кушелев:  Начинаем подготовку эксперимента на оборонном заводе...

    Фотоаппарат делает бракованные фотки 
    Так что придётся дождаться исправной регистрирующей аппаратуры, после чего начнётся полноценная подготовка эксперимента на оборонном заводе.




    А это шестерёнчатая 2D модель эфира из независимого источника. 

    Формы, механизмы, энергия наномира. Сообщение 87 372

    2D и 3D шестеренчатые модели эфира Фарадея Максвелла

    https://img-fotki.yandex.ru/get/98619/158289418.40d/0_178e25_134d56d0_XL.jpg

    Кушелевская 3D Шестеренчатая модель эфира Фарадея-Максвелла...

    http://img-fotki.yandex.ru/get/12/nanoworld.0/0_5a2b_745a6bd9_orig.gif




    Денис пишет:

    Из текста журнальной статьи 1992 года следует, что крестодвигатель представляет собой резонатор, присоединенный к источнику переменного тока, частота которого совпадает с собственной частотой 113 мгц. При такой частоте тока длина электрической волны в металле около двух метров.

    Кушелев: Действительно, двигатель 1992-го года представляет собой систему вибраторов Герца. Габаритный размер системы действительно существенно меньше длины волны в вакууме. Тем не менее это не мешает системе иметь сцепление с эфиром и отталкиваться от него практически без излучения.

    http://www.nanoworld.org.ru/data/01/data/images/slides/990415/162.jpg

    И не забывайте, что до начала работ Роджера Шоера я успел испытать несколько разных конструкций Emdrive:

    http://nanoworld.org.ru/data/01/data/texts.rus/20010307/006.jpg
    Подробнее: http://nanoworld.org.ru/data/01/data/te … 010307.htm

    Измерительный эксперимент на частоте 2.45 ГГц был проведён в лаборатории академика Эдуарда Давидовича Шлифера, поэтому Вам придётся критиковать не дилетанта Кушелева, а специалистов из лаборатории академии наук smile

    1998-12-28 Фрагмент отзыва академика Э.Д. Шлифера (н/п)

    Если теперь вернуться к сформулированной в записке идее о создании "новой энергетики, основанной на различных методах доступа к свободной энергии окружающей среды", то хотя автор и не конкретизирует, что он имеет ввиду, можно подразумевать, например, работы А. Кушелева ("Наномир").
    В этом свете, не углубляясь в философские посылки и физическую сущность процессов и явлений, изучаемых А. Кушелевым, можно утверждать следующее:
    Эти работы во многом носят пионерский характер и, по всей видимости, находятся в русле движения от незнания к знанию, движения, которое в XXI веке будет определять новый виток важнейших открытий.
    Работы А. Кушелева свидетельствуют о незаурядном искусстве экспериментатора, но отнюдь, не фокусника и мистификатора. Демонстрируемые реальные эффекты, явления и сами объекты красноречиво говорят об отсутствии какого бы то ни было шарлатанства и "чертовщины" – с одной стороны, но и о наличии еще многих трудностей в получении практически полезного результата – с другой. Каким именно окажется этот результат, прогнозировать трудно, но если работу не проводить, то результата не будет вообще.
    Решающее слово, как всегда, принадлежит эксперименту, который должен быть поставлен таким образом, чтобы недвусмысленно (и аппаратно регистрируемо) продемонстрировать возможность отбора в некую полезную "нагрузку" энергии, исходящей из объекта в отсутствие преднамеренно вводимой от стороннего источника.
    Если надежда на получение положительного результата в указанном в п. 3 эксперименте сохраняется, то, говоря словами Докладной записки г. Давыдова, разработкам А. Кушелева должна бы быть обеспечена (не знаю, кем) "помощь, не обусловленная традиционными представлениями об экономической целесообразности".
    Д.т.н., академик АЭН РФ Э.Д. Шлифер




    Формы, механизмы, энергия наномира. Сообщение 87 426

    Новости рубиновой / микроволновой энергетики и транспорта

    https://www.facebook.com/permalink.php? … 1358409965

    Александр Кушелев: А настоящее, стоящее, которое уже давно изобрели, испытали и внедрили инопланетяне, люди даже даром взять не могут. Мозгов-то не хватает... Вы можете включить уже готовую рубиновую "летающую тарелку"? Есть стандартное оборудование на оборонных заводах, от которого уже светился один элемент источника энергии: http://nanoworld.org.ru/topic/648/




    Формы, механизмы, энергия наномира. Сообщение 87 538

    Новости рубиновой / микроволновой энергетики и транспорта

    vasya пишет:Kushelev пишет:

    Формы, механизмы, энергия наномира. Сообщение 87 473

    Новости рубиновой / микроволновой энергетики и транспорта

    Видеозапись 37 режимов эксперимента в Дубне 2011-02-18

    Инвестор-S: А чем нам этот СВЧ-модуль не подходит?

    СВЧ модуль "Спрут-1"

    https://img-fotki.yandex.ru/get/102548/158289418.40e/0_17948e_a1984f6b_orig.jpg

    Магнетронный импульсный двухрежимный СВЧ модуль. Предназначен для передатчиков РЛС с повышенной точностью определения координат малоразмерных объектов, в том числе в акваториях морских портов и в аэродромных зонах. Состав модуля — мощный импульсный магнетрон, твердотельный источник питания магнетрона.

    Рабочий диапазон частот ... Ku-диапазон
    Выходная импульсная мощность, кВт ... не менее 22
    Длительность импульса, мкс ... 0,22÷0,5
    Напряжение питания ... 220 В, 50 Гц
    Скважность ... 1000,2000
    Габаритные размеры, мм ... 270х380х350
    Масса, кг ... не более 25

    Отличительными особенностями являются:
    изменяемый режим работы по длительности выходного импульса и по скважности выходного импульса;
    высокое качество спектральных параметров излучаемого сигнала;
    воздушное охлаждение модуля;
    встроенное расположение магнетрона в модуле.

    ***
    Или этот:

    Комплексированное устройство У52195    СВЧ модуль "Спрут-2"

    https://img-fotki.yandex.ru/get/143188/158289418.40e/0_17948f_9f3948c4_XL.jpg

    Магнетронный СВЧ модуль с наносекундными длительностями импульса. Предназначен для передатчиков РЛС с высокой точностью определения координат малоразмерных объектов в условиях сложных помех. Состав модуля — мощный импульсный магнетрон, система импульсного электропитания в твердотельном исполнении.

    Рабочий диапазон частот ... Q-диапазон
    Выходная импульсная мощность, кВт ... не менее 4
    Длительность импульса, нс ... 75÷150
    Напряжение питания ... 115В, 400 Гц
    Скважность ... 1100÷3000
    Расход жидкости для охлаждения магнетрона, л/мин ... 1
    Габаритные размеры, мм ... 280х360х335
    Масса в зависимости от комплектации, кг ... 21,25, 28

    Отличительными особенностями являются:
    короткоимпульсный режим работы с возможностью изменения длительности импульса;
    высокая надежность (минимальная наработка на отказ в режиме излучения не менее 1000 часов);
    высокие спектральные параметры излучаемого сигнала благодаря форме модулирующего импульса, близкой к прямоугольной;
    твердотельное исполнение источников питания.

    Кушелев: Так именно от СИЭП-1 (нижняя фотка) и светился рубиновый шарик в 2016-ом году: http://nanoworld.org.ru/topic/648/

    Инвестор S: Сколько стоит этот модуль?

    Кушелев: Я не в курсе.

    Инвестор S: Я спрошу в отделе сбыта.

    Кушелев: ОК!

    неужеле этот блок стоит дороже компа?

    Кушелев: Смотря какого. Компы бывают разные. А блок СИЭП-1 на заводе Плутон готовы собрать за 3 месяца. Ориентировочно за 3 миллиона рублей. Точную цену пока не назвали.



    Формы, механизмы, энергия наномира. Сообщение 87 342

    Новости рубиновой / микроволновой энергетики и транспорта

    Кушелев: Рубин для изготовления рубин-пьезокерамического источника энергии выслан из Китая, и в течение 10 дней будет у меня.

    https://img-fotki.yandex.ru/get/195637/158289418.39e/0_16a881_882e68f8_-1-XL.jpg

    А пьезокерамика уже находится в лаборатории Наномир.

    https://img-fotki.yandex.ru/get/226123/158289418.3e8/0_176fee_54c1ca9c_XL.jpg

    Александр Кушелев: Хочешь быстрее летать на браслетах и "летающих тарелках"? Подключайся!



    Формы, механизмы, энергия наномира. Сообщение 86 612

    Новости рубиновой / микроволновой энергетики и транспорта

    Видеозапись 37 режимов эксперимента в Дубне 2011-02-18

    Игорь Яковлев пишет:

    Александр Юрьевич, добрый день!
    Скажите, чем закончилась постройка супермагнетрона «Ловец снов» из велосипедного колеса? Не удалось настроить его на частоту микроволновки? Больше к экспериментам с этим устройством не возвращались?

    Кушелев: На этом направлении обнаружились следующие трудности:

    1. Для возбуждения резонатора типа "Ловец снов" на частоте 2.45 ГГц нужна мощность в сотни раз больше, чем для возбуждения сферического резонатора "шепчущей галереи" диаметром 9 мм на частоте 34 ГГц. Шарик светился от импульсного магнетрона мощностью 16 кВт. Для "ловца снов" аналогичная мощность превышает мегаватт. Это - главная трудность.

    2. Мне удалось настроить "ловца снов" до уровня добротности 5000. Это маловато. Нужно хотя бы 30 000. Технически возможно, но учитывая П1, бесперспективно.

    3. Вышла из строя детекторная секция на диапазон 1.78...4.0 ГГц. Без неё я не могу проводить измерительные и мощные эксперименты в этом диапазоне. Кстати, выходит из строя детекторной секции может означать, что в последнем эксперименте в микроволновке кратковременно выделилась мощность, которая многократно превышает мощность магнетрона. В таком случае мощные эксперименты на частоте 2.45 ГГц нужно продолжать в специально оборудованном помещении, что пока недоступно для меня.




    Формы, механизмы, энергия наномира. Сообщение 86 613

    Новости рубиновой / микроволновой энергетики и транспорта

    Кушелев: В настоящее время я считаю наиболее актуальными направлениями включение рубинового источника энергии от импульсного магнетрона и включение рубин-пьезокерамического источника энергии ударом.

    Оба варианта сравнительно безопасные, т.к. источник, состоящий из рубиновых шариков диаметром до 9 мм не может выдать излучение мощностью больше 10 кВт.

    Рубин-пьезокерамический источник на диапазон 4..6 ГГц не может выдать излучение мощностью более 300 кВт. Конечно, 300 кВт уже нельзя экспериментировать в жилом доме, но ударить "волшебный эллипсоид" можно хоть в лесу smile

    Кстати, очень удобный вариант для распространения рубиновой / микроволновой энергетики по планете. Достаточно выложить видеозапись процесса изготовления и включения, и каждый желающий сможет это повторить в любой точке планеты. Ведь рубин-пьезокерамический источник энергии может оказаться возможным изготовить из типовой пьезокерамики, например, pzt-8 и пластинок из синтетического рубина. Себестоимость материала на уровне 1000 USD, зато расчётная мощность типа 300 кВт. Склеил рубин-пьезокерамический эллипсоид, включил ударом и 300-киловаттный котёл отопления будет кипеть вечно...

    https://img-fotki.yandex.ru/get/46165/158289418.273/0_143ea9_98f94d21_L.gif





    Kushelev пишет:

    Попробуйте сами нарисовать элементарные силы, а потом просуммировать их.

    https://img-fotki.yandex.ru/get/196534/223316543.53/0_1ec3c8_c3ac8472_L.jpg

    Анатолий Шестопалов:

    Получилось все симметрично и машина никуда не должна ехать.

    https://img-fotki.yandex.ru/get/226123/223316543.53/0_1ec3c6_9599f51_L.jpg

    Я об этом знал и поэтому не понимал как может ваш кольцевой EmDrive отталкиваться от эфира

    https://img-fotki.yandex.ru/get/239438/223316543.53/0_1ec3c5_14f7868b_L.jpg

    и предположить даже не мог что Вы дуршлагом будете выключать ячейки

    https://img-fotki.yandex.ru/get/202427/223316543.53/0_1ec3c7_d56bb677_L.jpg

    Что касается вашей модели фотона, то быть солитоном это необходимое условие но не достаточное. Солитон это уединенная волна потому, что она движется в синергетически активной среде, содержащей внутренние источники энергии, которыми она "питается" (подпитывается). Но куда она движется одному богу известно. Примером солитона является фронт лесного пожара. Чтобы фотон двигался прямолинейно он должен быть EmDrive (генератором и двигателем одновременно). То есть состоять из вихрей эфира наподобие ваших конструкций из рубиновых шариков, при этом конструкций не симметричных.



    Kushelev пишет:

    Запросто! Может быть и Ruby Emdrive smile

    http://img-fotki.yandex.ru/get/5819/158289418.19d/0_fec91_d028a2c3_XL.gif
    Подробнее: http://nanoworld.org.ru/topic/1582/

    Анатолий Шестопалов:

    Хорошо бы еще здесь понять где у резонатора несеметричность за счет которой он может быть двигателем.



    Анатолий Шестопалов пишет:

    и предположить даже не мог что Вы дуршлагом будете выключать ячейки

    Кушелев: Вы же понимаете, что дуршлаг нужен лишь в качестве наглядного образа, а реальный шунт может больше напоминать резонаторный блок магнетрона smile А если у Вас есть два рубиновых полукольца, которые могут поворачиваться на втулках, то их уже не нужно шунтировать. Только поворачивать, направляя вектор тяги.



    Анатолий Шестопалов пишет:

    Чтобы фотон двигался прямолинейно он должен быть EmDrive (генератором и двигателем одновременно).

    Вы предполагаете, что солитон на поверхности воды является Emdrive (или его аналогом) и генератором?

    Фотоны - пассивные солитоны. Они теряют энергию по закону Хаббла. Поэтому и кажется, что "галактики разбегаются".

    Другое дело - электрон. Это уже активный солитон, т.е. стабильный процесс преобразования внутренней энергии эфира в колебательную форму.



    Kushelev пишет:

    Анатолий Шестопалов: Вы предполагаете, что солитон на поверхности воды является Emdrive (или его аналогом) и генератором?

    Солитон на воде, просто обязан быть Emdrive (или его аналогом) и генератором, чтобы не нарушать законы сохранения. Это такое же уникальное явление как и шаровая молния.

    Kushelev пишет:

    Фотоны - пассивные солитоны. Они теряют энергию по закону Хаббла. Поэтому и кажется, что "галактики разбегаются".

    Анатолий Шестопалов:  По моему мнению солитоны, где бы (в чем бы) они ни были, они не могут быть пассивными. То что предшествовало солитону - это широкополосный резонатор, который чем-то включается и на некоторое время становится генератором и подпитывается из эфира. А потом разваливается потому что перестает быть симметричным, т.е. резонатором.

    Kushelev пишет:

    Другое дело - электрон. Это уже активный солитон, т.е. стабильный процесс преобразования внутренней энергии эфира в колебательную форму.

    Анатолий Шестопалов:  По моему мнению весь наномир состоит из активных солитонов. Более подробнее я вам сегодня объяснить не смогу, так как эти качественные (феноменологические) представления у меня пока только на уровне интуиции.



    Kushelev пишет:

    http://www.nanoworld.org.ru/data/05/20021205/021.jpg
    Считайте, что каждая такая гнутая стрелочка - уголковый двигатель. Осталось найти суммарную силу smile

    Анатолий Шестопалов: Спасибо. Это для меня очень даже существенное замечание, благодаря которому, за 10-ть лет изучения ваших моделей наномира, у меня появилось ощущение что все пазлы сложились.




      Kushelev пишет:Анатолий Шестопалов пишет:

      композитный луч состоит из пучка (потока) самодвижущихся фотонов (солитонов) в который подмешаны ионы - аналог пескоструйки.

      Кушелев: Есть композитные лучи, в состав которых входят электромагнитные солитоны (фотоны, рентгеновские, гамма-кванты), но бывают и более простые по составу композитные лучи, где классические электромагнитные волны Фарадея-Максвелла фокусируются пучком ионов, а пучок ионов поддерживается взаимодействием с электромагнитной волной. Процесс аналогичен тому, что осуществляется внутри магнетрона, ЛБВ, клистрона...

      Если Вы продолжаете со мной спорить, то это означает что и мое объяснение механизма лучевого оружия инопланетян также является моим оригинальным, а не моделью Кушелева А.Ю. И так у меня получается два изобретения: 1) модель фотона, которая объясняет как он преодолевает огромные расстояния и при этом движется по прямой, а не как попало как это делают обычные солитоны; 2) технология обработки (резки) камня "композитным" лучом света без его расплавления, испарения или сублимации (испарения минуя расплавление).


      Анатолий Шестопалов пишет:

      у меня получается два изобретения: 1) модель фотона, которая объясняет как он преодолевает огромные расстояния и при этом движется по прямой, а не как попало как это делают обычные солитоны;

      Кушелев: Но солитоны как раз распространяются по прямой, если не взаимодействуют с другими объектами/процессами smile

      Анатолий Шестопалов пишет:

      2) технология обработки (резки) камня "композитным" лучом света без его расплавления, испарения или сублимации (испарения минуя расплавление).

      Кушелев: У инопланетян так и работают резаки, т.е. как пескоструйная машина, только "песчинки" маленькие (ионы) и летят с субсветовой скоростью.



      Анатолий Шестопалов пишет:

      То что предшествовало солитону - это широкополосный резонатор, который чем-то включается и на некоторое время становится генератором и подпитывается из эфира. А потом разваливается потому что перестает быть симметричным, т.е. резонатором.

      Солитоны могут терять энергию (большинство именно таких) на всех этапах своего существования. Естественно, что в активных средах могут существовать и такие солитоны, энергия которых увеличивается в процессе распространения. Я даже рассматривал в рассылке структурированные композитные лучи, которые могут усиливаться за счёт внутренней энергии эфира, т.е. являются процессами преобразования внутренней энергии эфира в колебательную форму.

      Но Вы же понимаете, что добыть энергию значительно сложнее, чем потерять smile

      Ссылки по теме:

      http://subscribe.ru/archive/science.new … 11839.html

      http://subscribe.ru/archive/science.new … 92956.html



      Анатолий Шестопалов пишет:

      весь наномир состоит из активных солитонов.

      Кушелев: Если Вы пишите об элементах кристаллоподобного эфира, планкионах, "шестеренках Максвелла", то безусловно. Что касается процессов возмущения эфира, то подавляющее большинство этих процессов - пассивно.



      Kushelev пишет:

      Но солитоны как раз распространяются по прямой, если не взаимодействуют с другими объектами/процессами smile

      Анатолий Шестопалов: То что солитоны распространяются по прямой нигде не написано, например здесь http://www.nkj.ru/archive/articles/7337/
      Я думаю, что это ложное впечатление сложилось потому что изучали солитоны в канале воды, в оптоволоконных кабелях и других одномерных средах, т.е. у солитона не было возможности двигаться вбок. Книжку Филиппова "Многоликий солитон я не читал", может там есть о солитонах в двумерных средах. Единственный пример солитона в двумерной среде известен мне из синергетики - горение лесного массива.

      Если бы лесной массив был однородной средой, то солитон распространялся бы прямолинейно.


      Анатолий Шестопалов пишет:

      Одним моим изобретением меньше.

      Кушелев: Вообще-то речь идёт  об открытиях smile



      Kushelev пишет:

      Но солитоны как раз распространяются по прямой, если не взаимодействуют с другими объектами/процессами smile

      Анатолий Шестопалов: То что солитоны распространяются по прямой нигде не написано, например здесь http://www.nkj.ru/archive/articles/7337/
      Я думаю, что это ложное впечатление сложилось потому что изучали солитоны в канале воды, в оптоволоконных кабелях и других одномерных средах, т.е. у солитона не было возможности двигаться вбок. Книжку Филиппова "Многоликий солитон я не читал", может там есть о солитонах в двумерных средах. Единственный пример солитона в двумерной среде известен мне из синергетики - горение лесного массива.



      Анатолий Шестопалов пишет:

      2) технология обработки (резки) камня "композитным" лучом света без его расплавления, испарения или сублимации (испарения минуя расплавление).

      Кушелев: У инопланетян так и работают резаки, т.е. как пескоструйная машина, только "песчинки" маленькие (ионы) и летят с субсветовой скоростью.

      Анатолий Шестопалов пишет: Одним моим изобретением меньше. Ну и слава богу! Возвращаемся к моему утверждению http://nanoworld.org.ru/post/87654/#p87654

      Кушелев Пишет:

      "Анатолий Шестопалов пишет:

      Чтобы мы ни изобретали, все это оказывается уже изобретено Кушелевым Александром Юрьевичем (С) sad"



      Михаил Смирнов: Саня не строй из себя супермена. Без тебя создают и космонавтику и роботехнику..

      Александр Кушелев: Вы забыли, что я показал Emdrive по центральному ТВ уже в 1992-ом году. А сегодня 2017-ый. Это Вы всё это время баклуши били, а я уже Ruby Emdrive сделал: http://nanoworld.org.ru/topic/1582/



      Денис пишет:

      Кушелев отказался провести простой публичный эксперимент с крестодвигателем в вакуумной камере.

      А чем Вас опыт Роджера Шоера не устроил? Он блестяще подтвердил мой опыт 1992 года и опыт Владимира Глушко, который он провёл до 1973 года! Получается, что 1992-ом году я независимо подтвердил опыт Владимира Глушко smile

      Просите теперь его "повторить для общественности" wink

      https://img-fotki.yandex.ru/get/54522/51185538.13/0_c2762_34790e9a_orig.jpg
      Подробности: http://globalwave.tv/forum/viewtopic.ph … ;start=120




      Формы, механизмы, энергия наномира. Сообщение 87 876

      Новости рубиновой / микроволновой энергетики и транспорта

      Комментарий ожидает модератора: http://ecologyofthinking.ru/ekologiya-m … mment-1316

      Кушелев: Заявка на Emdrive была подана в СССР Владимиром Глушко в 1973-ем году. Я испытал Emdrive независимо от Глушко в 1992-ом году и показал по центральному ТВ. В 2000-ом году я опубликовал научную статью в международном журнале, но американцы тщательно уничтожают всю информацию об испытаниях Emdrive до Роджера Шоера: http://nanoworld88.narod.ru/data/404.htm



      vasya пишет:

      А я рубиновые кирпичики заказывал.

      https://www.facebook.com/photo.php?fbid … amp;type=3

      https://img-fotki.yandex.ru/get/98619/158289418.410/0_17976b_305caa4_XL.jpg

      Кулелев: Присылайте их мне. Я их обработаю вместе с рубиновыми кирпичиками других размеров. Из них получатся резонаторы "морские камни", которые после включения будут более мощными источниками энергии, чем эллипсоиды:

      https://img-fotki.yandex.ru/get/6506/158289418.241/0_13b40c_a525fb26_XL.png
      Подробнее: http://nanoworld.org.ru/topic/1284/

      https://img-fotki.yandex.ru/get/3701/158289418.1ee/0_11daf3_6bc1be0f_orig.gif
      Подробнее: http://subscribe.ru/archive/science.new … 32201.html




      diprospan пишет:

      Тема: Двигатель нарушающий законы физики
      http://electrotransport.ru/ussr/index.php?topic=42534.0

      Формы, механизмы, энергия наномира. Сообщение 85 268

      Новости рубиновой / микроволновой энергетики и транспорта

      Ruby Emdrive для новичков

      Skype 2017-02-08:

      [20:17:41] *** Пользователь Новичок хочет внести вас в свой список контактов Skype
      Здравствуйте, Кушелев Александр Юрьевич, я хочу связаться с вами в Skype. ***
      [20:50:37] *** Кушелев Александр Юрьевич отправил контактные данные Новичок. ***
      [20:51:40] Новичок: Здравствуйте Александр Юрьевич
      [20:52:30] Новичок: Как ваши дела
      [21:35:32] Кушелев Александр Юрьевич: Отлично!
      [21:36:03] Новичок: Есть разговор
      [21:36:15] Кушелев Александр Юрьевич: У меня сейчас звук не работает.
      [21:36:23] Кушелев Александр Юрьевич: Вы пишите, а я появлюсь минут через 25
      [21:37:57] Новичок: Дак разговор Александр Юрьевич и подразумевает разговор а не писанины когда удобно будет вам
      [22:06:24] Кушелев Александр Юрьевич: Тема какая?
      [22:07:03] Новичок: Ну вы же специалист по рубинам
      [22:07:34] Кушелев Александр Юрьевич: И?
      [22:08:50] Новичок: Когда будет пуск движетеля
      [22:09:23] Новичок: Рубинового
      [22:10:06] Кушелев Александр Юрьевич: Неизвестно
      [22:10:22] Новичок: А в чем проблема
      [22:11:53] Кушелев Александр Юрьевич: Нужны либо деньги, либо административный ресурс.
      [22:14:46] Новичок: А сколько нужно ресурсов чтобы так без проверок и исследований собрать и взлететь
      [22:16:44] Кушелев Александр Юрьевич: Нужно нормально измерить. Аппаратура для таких измерений в нормальной лаборатории стоит от 200 до 600 тыс. долл. Я работаю на б/у аппаратуре за 700 долл. Поэтому измеряю с большим трудом и очень долго.
      [22:17:22] Кушелев Александр Юрьевич: Включить можно от магнетрона с модулятором. На заводе Плутон такой блок стоит около 500 000 USD
      [22:17:36] Кушелев Александр Юрьевич: Имея такую технику можно включить всё за неделю
      [22:17:48] Кушелев Александр Юрьевич: А с голыми руками можно включать всю жизнь
      [22:18:13] Кушелев Александр Юрьевич: Есть вариант попробовать пьезо-керамический генератор, который может быть включится ударом
      [22:18:27] Кушелев Александр Юрьевич: Но и 400 USD для этого проекта инвесторы за год не собрали
      [22:18:45] Новичок: А насколько целесообразно это покупать ведь можно арендовать
      [22:19:45] Новичок: Гарантии нужны что он запуститься
      [22:20:22] Кушелев Александр Юрьевич: Попробуйте арендовать. Я только за. На Плутоне, например, сказали, что могут изготовить, если оплатят эту работу. Готового у них нет
      [22:20:35] Кушелев Александр Юрьевич: Гарантий в наше время не даст даже Бог smile
      [22:21:48] Новичок: Я не могу Вас понять для чего нужно потратить 500 000 чтоб это не запустилось
      [22:22:20] Новичок: Достаточно вашего слова
      [22:23:09] Новичок: Меня больше бюджетный вариант интересует что в нем плохого
      [22:24:09] Кушелев Александр Юрьевич: Что за бюджетный вариант?
      [22:25:26] Новичок: 400$ сами говорите
      [22:25:41] Кушелев Александр Юрьевич: Давайте начнём с него
      [22:25:46] Новичок: А что там у Вас с инвестором
      [22:25:52] Кушелев Александр Юрьевич: С каким?
      [22:26:50] Новичок: Ну вы в эфире про зп 350 000 кто-то собрался Вам платить
      [22:28:13] Кушелев Александр Юрьевич: Он хочет 90% долевого участия
      [22:28:19] Кушелев Александр Юрьевич: Другие инвесторы не согласны
      [22:32:07] Новичок: Да пусть. Он желает дальше вы же в здравом уме
      [22:32:34] Новичок: А других инвесторов это сколько
      [22:32:39] Кушелев Александр Юрьевич: Больше 100
      [22:32:51] Кушелев Александр Юрьевич: Но кушать нечего...
      [22:33:13] Кушелев Александр Юрьевич: В Китай отправили на днях 1500 USD на рубин, а на еду не хватило
      [22:33:41] Новичок: Я значить 101 мне за кем очередь занимать
      [22:33:54] Кушелев Александр Юрьевич: http://nanoworld.org.ru/topic/1128/page/81/
      [22:34:01] Кушелев Александр Юрьевич: Инвесторы в очереди не стоят
      [22:34:16] Новичок: Прекрасный ответ
      [22:37:05] Новичок: А если серьезно недавно общался с парнем с Украины  он задумал тоже самое но только с другой стороны видит этот запуск что интересно он с вашеми трудами не знаком просто щелк и заговорил про вашу теорию о рубинах
      [22:37:35] Кушелев Александр Юрьевич: ОК
      [22:38:27] Новичок: Можем не успеть запуститься поэтому и предлагаю пробовать с малого
      [22:38:38] Кушелев Александр Юрьевич: С керамики?
      [22:38:44] Кушелев Александр Юрьевич: Давайте попробуем
      [22:39:08] Кушелев Александр Юрьевич: Вы в какой стране находитесь?
      [22:39:26] Новичок: Что для этого нужно
      [22:39:42] Новичок: Россия
      [22:40:42] Кушелев Александр Юрьевич: Если заказывать в Китае пьезокерамику, то нужно будет переводить в Китай Western Union
      [22:41:07] Кушелев Александр Юрьевич: Сумма там 396 USD, если мне не изменяет память
      [22:41:23] Новичок: Почему Китай мы делаем такое
      [22:41:37] Кушелев Александр Юрьевич: Какое?
      [22:41:47] Кушелев Александр Юрьевич: И по чём?
      [22:42:07] Кушелев Александр Юрьевич: Зеленоград делает, но раза в 3 дороже
      [22:42:16] Новичок: Нет я Вас хотел спросить мы не производим
      [22:42:27] Кушелев Александр Юрьевич: Тогда Китай
      [22:42:28] Новичок: А качество где
      [22:42:37] Новичок: Лучше
      [22:42:50] Кушелев Александр Юрьевич: Качество примерно одинаковое
      [22:43:43] Новичок: Просто я хочу чтоб качественный запуск был чтоб у всех сомнения отпали
      [22:44:48] Кушелев Александр Юрьевич: Сомнения могут отпасть только после включения.
      [22:45:10] Кушелев Александр Юрьевич: Специалисты из Дубны сомневались даже после того, как один шарик засветился
      [22:45:27] Кушелев Александр Юрьевич:

      http://nanoworld88.narod.ru/data/228_files/0_487d7_70d27fe2_orig.gif
      [22:45:46] Кушелев Александр Юрьевич: Провели повторный эксперимент:

      http://img-fotki.yandex.ru/get/9067/158289418.af/0_ae264_4777e0aa_orig.gif
      [22:45:57] Кушелев Александр Юрьевич: Подробнее: http://nanoworld.org.ru/topic/648/
      [22:46:29] Кушелев Александр Юрьевич: После этого вышли со мной на связь и сказали, "ну, раз ты угадал, давай остальные шарики, будем включать..."
      [22:47:12] Кушелев Александр Юрьевич: Но с 2011 года ускоритель больше не удалось включить ни разу...
      [22:47:39] Кушелев Александр Юрьевич: Зато в 2016-ом удалось засветить шарик от магнетрона: http://nanoworld.org.ru/topic/1573/
      [22:48:02] Кушелев Александр Юрьевич: Можем попробовать и без магнетрона, если купим керамику.
      [22:48:53] Новичок: Я про включения понял как взлетать он будет
      [22:49:23] Кушелев Александр Юрьевич: Двигатель можно набрать из одинаковых шариков
      [22:49:59] Кушелев Александр Юрьевич: Или монокристаллический:

      http://img-fotki.yandex.ru/get/9816/158289418.117/0_dd5e7_56bba013_XL.jpg
      [22:50:07] Новичок: Количество для миниатюрного ну например для дрона
      [22:51:15] Кушелев Александр Юрьевич: Для дрона нужно как минимум 4, т.е. сколько винтов, столько и рубиновых движков. На картинке один рубиновый движок, рассчитанный на силу тяги 0.5 кг. Весит он 0.5 грамма
      [22:52:14] Новичок: Вес от пяти кило интересует подъемная сила
      [22:52:30] Кушелев Александр Юрьевич:

      http://nanoworld88.narod.ru/data/368_files/0_c5e87_.jpg
      [22:52:39] Кушелев Александр Юрьевич: Тогда 10 таких
      [22:52:57] Кушелев Александр Юрьевич: Или полсотни 3-мм рубиновых шариков
      [22:53:03] Кушелев Александр Юрьевич: Они по 5 центов
      [22:54:24] Кушелев Александр Юрьевич: Правда, отверстия в шариках по 35 центов:
      [22:54:40] Новичок: Платформу продумывали уже как крепиться будет
      [22:54:46] Кушелев Александр Юрьевич:

      http://nanoworld88.narod.ru/data/418_files/0_f8d97_.png
      [22:54:54] Кушелев Александр Юрьевич: Платформа не нужна
      [22:55:08] Кушелев Александр Юрьевич: Если дрон, то вместо винтов будут рубиновые резонаторы
      [22:55:15] Новичок: Тоже в Китае сверлить надо
      [22:55:48] Кушелев Александр Юрьевич:

      http://img-fotki.yandex.ru/get/6843/158289418.12f/0_f4dbe_d820c7ad_orig.png
      [22:55:53] Новичок: Да для эксперимента достаточно дрона
      [22:56:03] Кушелев Александр Юрьевич: Подробнее: http://nanoworld.org.ru/topic/811/
      [22:56:09] Кушелев Александр Юрьевич: Сверлить можно где угодно.
      [22:56:12] Кушелев Александр Юрьевич: В Китае дешевле
      [22:56:52] Новичок: Тоесть в заказе указываешь сверловку
      [22:57:29] Кушелев Александр Юрьевич: Она уже прайсе:

      http://nanoworld88.narod.ru/data/418_files/0_f8d97_.png
      [22:57:47] Кушелев Александр Юрьевич: Я научил китайцев и оптическую ось ориентировать
      [22:58:00] Новичок: Двигатели электрические значит выкидываем
      [22:58:11] Кушелев Александр Юрьевич: Можно
      [23:01:59] Новичок: Александр Юрьевич мне можете не чего не доказывать я готов даже без подтверждения каких то комиссий заняться с Вами запуском мне уже самому интересно почему ступор такой в развитии если это изобретение летает почему бы и нет если никто этим не занимается
      [23:03:10] Кушелев Александр Юрьевич: ОК
      [23:05:47] Новичок: Составьте пожалуйста прайс необходимых расходов для рабочей модели
      [23:06:16] Новичок: А видео Александр Юрьевич где посмотреть
      [23:07:50] Кушелев Александр Юрьевич: Один момент
      [23:10:15] Кушелев Александр Юрьевич: Здесь копия переговоров с китайской фабрикой, которая готова прислать пьезокерамику за 396 USD: http://nanoworld.org.ru/post/59120/#p59120
      [23:10:53] Новичок: Рубины и так далее
      [23:11:05] Новичок: И ссылку
      [23:11:56] Кушелев Александр Юрьевич:

      https://img-fotki.yandex.ru/get/37861/158289418.27d/0_145792_3125b233_orig.png
      [23:12:04] Кушелев Александр Юрьевич: Это прайс на пьезокерамику
      [23:12:43] Кушелев Александр Юрьевич: Правда, эта фабрика нас кинула
      [23:13:03] Новичок: Вот козлы
      [23:15:01] Новичок: Вопрос информацию можно в рубин помещать
      [23:15:15] Новичок: Как на флешку
      [23:16:01] Кушелев Александр Юрьевич: Здесь пошли переговоры с другой фабрикой. Она уже цивилизованно продаёт: http://nanoworld.org.ru/topic/597/page/30/
      [23:16:13] Кушелев Александр Юрьевич: Информацию можно, но ... сложно
      [23:16:40] Кушелев Александр Юрьевич: Вот прайс на 394 USD:

      https://img-fotki.yandex.ru/get/44369/158289418.332/0_15db5d_c6a35ae9_XL.png
      [23:16:53] Кушелев Александр Юрьевич: Подробнее: http://nanoworld.org.ru/topic/597/page/30/
      [23:19:05] Новичок: Я хочу вам предложить чтоб Вы попутно от основного проекта углубились в эту тему и объяснили что и как
      [23:20:20] Новичок: То есть сложность в чем?
      [23:21:08] Кушелев Александр Юрьевич: Сложность в том, что инвесторы не могут оплатить пьезокерамику и рубиновые пластины для изготовления этого резонатора.



      https://www.facebook.com/alex.mirzoev/v … 135412625/

      Александр Кушелев: Мир всегда "сходил с ума", т.е. большинство всегда дергадировало, деградирует и будет деградировать. Но ... меньшинство развивается. И постепенно занимает место, которое освобождается от деградировавшего большинства. Размножается, и цикл повторяется. Кстати, кому интересно поднять цивилизацию на новый уровень развития, нужно заглянуть сюда: http://nanoworld.org.ru/topic/1582/



      https://www.facebook.com/begemot.media/ … 146091087/

      Александр Кушелев: Если Путин узнает, что можно получить 10 в семнадцатой степени евро (100 000 000 000 000 000 евро) от внедрения пикотехнологии белков и столько же от создания рубиновой энергетики (развитие проекта Emdrive, входящего в комплексный проект "Наномир" от 1992 года), то он безусловно утысячерит свои капиталы. Подробнее о Ruby Emdrive: http://nanoworld.org.ru/topic/1582/



      Крокодил наглядно показывает действие эфироопорного двигателя рыбьей (змеиной) волны - Rubi EmDrive Кушелева

      См. ссылку   Создаём теорию "микроволновой змеи"- шеврона


      Формы, механизмы, энергия наномира. Сообщение 87 510

      Двигатель крокодильей волны

      https://img-fotki.yandex.ru/get/58717/158289418.40f/0_1795fb_a2dbd871_orig.gif
      Оригинальное видео: https://www.facebook.com/shamancbd/vide … 517340803/
      Копия: https://cloud.mail.ru/public/8Fkp/N1NMZNcDt




      http://nanoworld.org.ru/topic/699/page/21/

      Анатолий Шестопалов пишет:

      Поздняков Андрей: через 5 лет нефть, как энергоноситель, никому будет не нужна, ни какая, даже сланцевая, даже даром (тоже самое уголь, газ, гидроэлектростанции и т.п.)

      https://img-fotki.yandex.ru/get/220200/223316543.53/0_1ec8e7_abbf1ddf_L.jpg
      https://youtu.be/kHnMVCaQo0w?t=44m33s

      Кушелев: Может быть через 5 лет, а может быть и в этом году...





      Расширенная программируемая архитектура белков

      Проект Пикотехнология Белков Онлайн

                                                                                                        

      Пикотехнология белков, ДНК, РНК. Часть 1

      Пикотехнология белков, ДНК, РНК. Часть 2   

      Пикотехнология белков, ДНК, РНК. Часть  3



      Формы, механизмы, энергия наномира. Сообщение 87 365

      Пикотехнология белков, ДНК, РНК - 3

      Татьяна Рясина пишет:

      поменять углы поворотов

      Кушелев: Композиционные углы не менять надо, а настроить один раз. Дальше они уже будет слегка меняться с учётом физико-химических взаимодействий. И продавать нужно не программу, а конкретные структуры белков. Продажа прогрммы может привести к дискредитации научного направления, т.к. пользователи будут использовать её некорректно и получать неправильные результаты. Яркий пример - некто Leo, который взялся проводить экспертизу одной из первых версий программы Пикотех. Для начала он её изуродовал, т.е. упростил до такой степени, что она практически перестала работать. После этого раскритиковал. Чтобы этого безобразия не повторялось в будущем, нужно не программу продавать, а заказы на структуры белков выполнять. Онлайн-сервис - это тоже заказы. Но на уровне Пикотех-2D они могут выполняться автоматически. На уровне 3D пока лишь с ручной доработкой.

      https://img-fotki.yandex.ru/get/215803/158289418.40d/0_178d08_42496493_orig.png



      Татьяна Рясина пишет:

      (Кстати, а можно сделать программу, которая виртуально кристаллизует белок и показывает рентгенграмму ?????  ))))))  Т.е. сделать симулятор РСА )))))

      Можно, можно. И скатерть-самобранку можно. Ищите инвестора smile



      Формы, механизмы, энергия наномира. Сообщение 87 374

      Пикотехнология белков, ДНК, РНК - 3

      krooto пишет: 

      АЮ, то есть ваш алгоритм показывает только самую базовую структуру белка ?
      А как он свернется дальше может уже показать только РСА ?

      Kushelev пишет:

      А чем Вас не устроили 6 участков разных лизоцимов, которые замкнулись через дисульфидные мостики?

      Композиционный код и формы аминокислот могут показать геометрическую модель белка, который построен рибосомой. Естественно, что в процессе построения белка он деформируется за счёт взаимодействия элементарных частиц между собой. Без учёта этого взаимодействия модель не может иметь пикотехнологическую точность в дальней зоне. Но в ближней зоне точность в большинстве случаев получается. Вы же знаете, что параметры альфа-спирали известны с высокой точностью, т.к. это - периодическая структура. Большинство белковых молекул содержат протяженные участки альфа-спиралей. Эти зоны программа "Пикотех-3D" показывает идеально. Правда, в том случае, если после сборки рибосомой молекула белка не модифицировалась. Модифицированные молекулы нужно естественно моделировать с учётом этой модификации.

      Что касается рентгена (РСА), то он часто не помогает определить даже тип белка, т.е. что преобладает в его структуре, альфа-310-спирали или пи-бета-спирали. Поэтому программа Пикотех даже на уровне вторичной структуры даёт на порядок более ценную информацию, что РСА. Естественно разные методы дополняют друг друга.

      https://img-fotki.yandex.ru/get/244791/158289418.404/0_1786ae_a2c56a57_orig.png
      Если Вы знаете, что от и до идёт альфа-спираль, то РСА Вам уже в этом вопросе не даст даже 1% полезной информации.

      https://img-fotki.yandex.ru/get/205820/158289418.404/0_1786aa_d8df5a21_orig.png
      РСА не может с такой точностью определять вторичную структуру. Естественно, что третичную структуру РСА определяет условно. Сами подумайте, если вместо пи-спирали он показывает альфа или вообще "нет структуры", то о какой 3D-точности может идти речь? smile



      https://www.ncbi.nlm.nih.gov/protein/74 … SDMTTNU015

      https://www.ncbi.nlm.nih.gov/nuccore/743960172

      >ENA|BAQ14176|complement 2013 nucleotides
      gtggtaaagataacatatccgttattttgtttgaaggagagtgtgaatatgataggaacc
      aaattaggtaataggtatgaacttcttgaaaaagttggagagggtggtatggctacagtt
      tataaagctaaatgccattacctaaatagatttgtcgcaataaagatattaaaagagcaa
      ttttgcagtgacaaagaatttgtagaaaaatttaaaagagaagcaacttcagtagcgagc
      ttatcagataacaatatagtaaatatttatgatgtaggttctgaaaataatatacattat
      atagttatggaatatgtagatggtaaaactttaaaggaattaatagtagaaaaagggaaa
      attgatcctaaggaaactgttagaatatcaaaacaaatagctagtgctttggtttgtgct
      catagaaacaatattatacatagagatataaaaccacacaatatattagttacaaaagaa
      ggaattgttaaggttacagattttggtatagcaaaggcttcaaattcagctactataaca
      aattctagtaaagtaatgggatcagctcattatttttcaccagaacaagctaaaggaagt
      tttgtggactcaagaactgatatatattctttaggtatagtaatgtatgaaatgcttgtg
      ggaaaagttccattcgatggagagagccctgtatctgtagcagtaaagcatatacaaaat
      gaagtagtagcaccaaaagaaatagatgataaaattccagaaagtttaaatagtttagta
      ctaaagtgcttggaaaaaaatcctgtaaaaagatatcaaactataaaaaatttagaagag
      gacttagctagaatagaaaataatgaaaatatattaaatggatctagcaatatatcagaa
      aacgatgttactagagtaatggacacagcggttataaatgacaaaataaaagaaatggct
      caaaatggtgagtatgaagatgatgatgaggaatatgaagatgatgatgaggaatatgaa
      gatgaagaggatgaaatagaggataaaaagaaaagaagtaataagggtaaaacaaataaa
      aaattaatattaggaatagctatggcagttttatttctagttgtaggatctgtatctgca
      tacttggccttcaataaatcaggagggaaaaaggtagaagttcctaatgtagtaggactt
      actaaagaagaagcggaaaaggtattaagtgagaaaaaattaaaattagtagtagctcaa
      aaggttaaaaatgaaaaaaaggaaggaactataatagaatcttatccaaaatccggtgaa
      aaagtagcagaaaattccgaagtaagagttagtataagttctgggaatgtagtagttgtg
      cctaatttaaagggaatggaattagaggccgctaaaaaagcaatacaagatcttaaatta
      aaagtagggaatgtaaaatatgaatttaatgacaatgtagcttctggaaaagtaataagt
      caaactccagatatagatgcagaattaaaagaaggagaagaaattagtttagttataagc
      aatggtccagaaattaaatactcaacagtacctaacttaataggaaaatctatagatgga
      gctcaaaatgctttagctaatgcaggactatctatgggaggctcaaaggctattattaca
      gaagatcaatccttagatggccaagtggcatcacaaagcataggtgcaggacaaagcata
      aaacaaggttcttccgtaagtatatcctattataaatacaaaaaaccagaaccaaaacca
      gacccaaaaccagatacagatacaggtaaggatccaggaacagacacaggtaagaatcca
      ggaacagacacaggtaaggacccaggaacagatacaggcaaggatccaggaacagataca
      ggtaaggatccaggaacagatccaggaacagatacaggcaaggatccaggaacagacaca
      ggtaaggattcaggaactactcctaaaaaataa

      https://img-fotki.yandex.ru/get/218038/158289418.408/0_1789ea_a6723a52_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/117896/ … 6_orig.png

      Фрагмент:

      https://img-fotki.yandex.ru/get/235015/158289418.408/0_1789ec_3ca8357b_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/195125/ … 9_orig.png

      https://img-fotki.yandex.ru/get/198613/158289418.408/0_1789ed_bab1c6f4_orig.png

      https://img-fotki.yandex.ru/get/114207/158289418.408/0_1789ee_7b85f5c2_orig.png

      Изменение бета- и пи- композиционных углов существенно изменило форму модели фрагмента белка.



      https://www.ncbi.nlm.nih.gov/protein/11 … SDMTTNU015

      https://www.ncbi.nlm.nih.gov/nuccore/1145424954

      >ENA|SJN11245|4035 nucleotides

      https://img-fotki.yandex.ru/get/102548/158289418.408/0_1789f3_66042d1b_orig.png

      https://img-fotki.yandex.ru/get/102548/158289418.408/0_1789f4_bb72d67a_orig.png



      Пикотехнология белков, ДНК, РНК - 3

      https://www.ncbi.nlm.nih.gov/protein/10 … W6YTK2A01R

      https://www.ncbi.nlm.nih.gov/nuccore/1036951433

      >ENA|XP_017074914|4821 nucleotides

      3D-модели пока годятся для топологического, но не для параметрического анализа. Ждём интерактивную версию программы Пикотех для точной настройки композиционных углов. Хотя и это - не панацея, т.к. у большинства аминокислотных остатков есть два изменяемых угла. Композиционный и транспозиционный. Причём транспозиционный меняется на десятки градусов в зависимости от физико-химических условий. А у пролина есть третий изменяемый угол. Есть ещё метионин, который гнёт альфа-310-спирали. Так что работы по совершенствованию программы Пикотех хватит на много версий smile

      Но программой Пикотех 2D можно пользоваться уже сегодня, т.к. она даёт исключительно надёжные результаты и богатейшую информацию для анализа. Вместе с данными РСА программа Пикотех 2D может увеличить эффективность анализа белковых структур на несколько порядков. А для белков, которые не кристаллизуются (их 97%) только программа Пикотех 2D может дать важнейшую информацию о структуре.

      https://img-fotki.yandex.ru/get/222565/158289418.40b/0_178b58_af6f5f59_orig.png

      https://img-fotki.yandex.ru/get/222565/158289418.40c/0_178b59_4c15d005_orig.png

      https://img-fotki.yandex.ru/get/176331/158289418.40c/0_178b5a_eeff637d_orig.png


      https://img-fotki.yandex.ru/get/30602/158289418.40c/0_178b5d_634f26ee_orig.png

      https://img-fotki.yandex.ru/get/172272/158289418.40c/0_178b5e_99545428_orig.png

      https://img-fotki.yandex.ru/get/106972/158289418.40c/0_178b5f_7867abe1_orig.png



      Формы, механизмы, энергия наномира. Сообщение 87 357

      Пикотехнология белков, ДНК, РНК - 3

      http://humbio.ru/humbio/molevol/000199bc.htm

      Цитата: По взаимной ориентации в структуре ДНК различаются прямые, инвертированные, симметричные повторы, палиндромы, комплементарные палиндромы и т.п.
      Конец цитаты.

      Кушелев: Оказывается на уровне нуклеотидных последовательностей это уже широко известно...



      http://humbio.ru/humbio/molevol/000199bc.htm

      Цитата: периодичность повторений ДНК может иметь очень сложную структуру, когда короткие повторы включены в более протяженные или окаймляют их и т.д.

      Кушелев: Оказывается на уровне нуклеотидных последовательностей это уже широко известно...


      Кушелев: А вот и одна из онлайн-систем для поиска повторяющихся нуклеотидных последовательностей: http://bioinfo.lifl.fr/mreps/mreps.php


      Формы, механизмы, энергия наномира. Сообщение 87 360

      Пикотехнология белков, ДНК, РНК - 3

      Skype, 2017-04-27:

      Кушелев Золдраксу: Существует ли сервис, который ищет в геноме или в большом файле типа fasta повторяющиеся куски нуклеотидной последовательности? Последовательность заранее неизвестна. Известно только, что 3...99 нуклеотидов должны 3...30 раз повториться подряд.
      Такие повторы соответствуют программным спиралям белка: http://nanoworld.org.ru/post/87005/#p87005

      [9:18:21] Zoldrax: Так сразу не скажу. Есть много программ для поиска геномных повторов. Какая подойдет надо разбираться. Первое что нагуглилось https://tandem.bu.edu/trf/trf.html
      [9:22:16] Zoldrax: Чтобы искать не по геному целиком, нужно вместо генома в программу подавать CCDS.
      [11:09:58] Кушелев Александр Юрьевич: ЗдОрово! Спасибо!



      Формы, механизмы, энергия наномира. Сообщение 87 322

      Пикотехнология белков, ДНК, РНК - 3

      Гиперзвуковые глиссады белковых конвейеров

      Последовательность аминокислот создают в ближней зоне белковой молекулы гиперзвуковую глиссаду для реагентов.

      Я пришёл к этому выводу в результате следующих рассуждений. Хаотическое движение молекул воды возбуждает радикалы аминокислот, которые начинают "звенеть", подобно камертону при воздействии на него белым шумом.

      Гиперакустическое поле приводит к эффекту акустической нано-левитации, т.е. захвату молекул, настроенных на данную частоту и удержание в глиссаде.

      Изменение гиперакустического поля по программе (по нотам) приводит к программированию многостадийных био-химических реакций. Молекулы реагенты перемещаются по гиперакустической глиссаде, которая имеет вид разветвлённой конвейерной сети. В процессе перемещения по конвейеру химические соединения претерпевают запрограммированные превращения.

      Высота нот (частота звучания) радикалов аминокислотных остатков направляет химические соединения вдоль глиссады. Многозвучия ориентируют и сдвигают химические соединения до расстояний их взаимодействия и превращения в продукты реакций.

      https://img-fotki.yandex.ru/get/228174/158289418.409/0_178a47_927b6cb7_orig.png

      Симметричные реакторы позволяют создавать многопоточные биохимические реакции повышенной надёжности и производительности.



      Формы, механизмы, энергия наномира. Сообщение 87 317

      Пикотехнология белков, ДНК, РНК - 3

      Невозможная музыка белков

      Письмо Дидье Маруани / Didier Marouani от Кушелева

      Dear Didier!
      Can you write music based on the unusual music of building a protein molecule? The musical size is 7/8. See the attached files.

      Warm wishes,
      Your Alexander Kushelev

      Russian original:

      Дорогой Дидье!
      Можешь ли ты написать музыку на основе необычной музыки сборки белковой молекулы? Музыкальный размер 7/8. Смотри вложенные файлы.

      midi: https://cloud.mail.ru/public/AJFi/4d2BwBDCW

      https://img-fotki.yandex.ru/get/57985/158289418.409/0_1789fc_d7afb38c_orig.png

      https://img-fotki.yandex.ru/get/194869/158289418.408/0_1789f6_fceef9ba_orig.png

      https://img-fotki.yandex.ru/get/52325/158289418.408/0_1789f7_e8431976_orig.png



      Формы, механизмы, энергия наномира. Сообщение 87 318

      Пикотехнология белков, ДНК, РНК - 3

      Ищем музыку Кушелева с музыкальным размером 7/8 в базе нуклеотидных последовательностей.




      https://www.ncbi.nlm.nih.gov/nucleotide … TZNP3C8014

      KU725248

      >ENA|KU725248|511 nucleotides


      https://img-fotki.yandex.ru/get/98619/158289418.409/0_178a03_2e43facb_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/172684/ … 9_orig.png

      Здесь мы не видим искомой последовательности нот. Что это значит? Это значит, что данный белок построен со сдвигом рамки считывания на 1 или 2 позиции. В этом случае можно сказать, что музыка спрятана, но достаточно сдвинуть рамку считывания, и она проявится.

      https://img-fotki.yandex.ru/get/236311/158289418.409/0_178a04_af05c877_orig.png

      https://img-fotki.yandex.ru/get/233608/158289418.409/0_178a05_13489adb_orig.png

      Изменение углов бета- и пи-спиралей на 30 градусов существенно меняет форму модели белка. К сожалению, уточнить форму моделей мы сможем только после создания интерактивной верстии программы Пикотех-3D.



      Пикотехнология белков, ДНК, РНК - 3

      Ищем 5*ghphpti

      https://blast.ncbi.nlm.nih.gov

      https://www.ncbi.nlm.nih.gov/protein/10 … U56KV12014

      https://www.ncbi.nlm.nih.gov/nuccore/1084799531

      http://molbiol.ru/scripts/01_12.html

      >ENA|OGQ36638|complement 1398 nucleotides
      atgaagttcagactttttctaatctttttaccgcttattaccatttgttcccttgcagaa
      gctggtgatttaaagattgaaaagaggatcgccggggaaaatctctcccttgttttgtct
      gaaggggagaaaatttatgagctctacacctttatccccgattcagcgcgggatccattc
      gcgcagggaacccctctctttctcggggttattgagagaagcggtgataaacaaagggtg
      atctattttcataatgccacggactcctttccagctgatctcaggattgtagatgggaaa
      attttcgtcctgctacaggactacaatgggaagggcggtaagattatcgagccggtttcc
      ggcagtgagatttattcgggattaatagggagaggtctatgggatatgctagataatacg
      ccgaccattcgtcatcctgagccgaccattcgtcatcctgagccgaccattcgtcatcct
      gagccgaccattcgtcatcctgagccgaaggcgaaggatctcaacacgcgagattgcttc
      gcttcgctcgcaatgacgaatacgatcgcaatgtactatgtttcatctggtgagttattc
      gaggttttaaatggagaaaaaagaagattagctgatttaaatccctataatagaatagaa
      aagatttccgtaaataaagatgggatttatatctcatgtgatgaggggctgcttctttac
      gattttttacgtgcggggctgataaaaataacaaacgaatcaccaccttggtttaaagca
      gaagcaaatggcggggttttatatcttgagacaaatgagatcagaagatggtccaatacg
      gaagatgcaaagagttattacaagtcggattccgagatatggtttataaagaagaatacc
      gattcacttttggttatcgatgataaaataacaattatttcaaatggagagcctaattct
      attgaggtgggagaggaggattcctttgcaaacctgagagacgcggttttttcagcaggt
      tcaattattatttattacagcgatacgatttccaggattattcgcggcattaaaagacgc
      atcaggttgcatccgaatgatggtgacagggatttattggcgcagctcctcaaagaccag
      aaaattgacgctgacgtaatattctcgattgtgcgggaggatctgaatgcgtcttccaac
      aatgaagagattatcaggaacaaactctttgccctctcgctcctcgaattattaggagaa
      gagggatttgaggagggtaagcgtatttatttggaatgggctcactcaatttcggaaagc
      atagagaagatttttatcgaaaaactgaaaaagatcgatccccaaaaaaccaacgaacta
      cttattaagaaatattaa

      https://img-fotki.yandex.ru/get/197852/158289418.409/0_178a07_664ec1f4_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/215222/ … b_orig.png

      В этом белке музыка Кушелева тоже спрятана, но ...

      Фрагмент:

      https://img-fotki.yandex.ru/get/196102/158289418.409/0_178a0a_788c7eb_orig.png
      Сдвиг рамки считывания привёл к изменению нот, но не музыкального размера!

      https://img-fotki.yandex.ru/get/223280/158289418.409/0_178a0e_351b8b01_orig.png

      https://img-fotki.yandex.ru/get/218038/158289418.409/0_178a09_1bbefd85_orig.png

      https://img-fotki.yandex.ru/get/194550/158289418.409/0_178a30_eb33496_orig.png
      Музыка в стандарте MIDI: https://cloud.mail.ru/public/ET8V/ZXmt9rGVo

      Мы можем послушать другую музыку с размером 7/8. При этом мы сможем услышать и две спрятанных мелодии с размером 7/8. Одна из них - 4 такта музыки Кушелева.

      https://img-fotki.yandex.ru/get/194550/158289418.409/0_178a0b_ce5edd65_orig.png

      https://img-fotki.yandex.ru/get/233608/158289418.409/0_178a0c_2ee076b5_orig.png

      https://img-fotki.yandex.ru/get/196258/158289418.409/0_178a0d_db175d15_orig.png

      https://img-fotki.yandex.ru/get/215222/158289418.409/0_178a0f_edfb70c2_orig.png

      Изменим бета- и пи- композиционные углы

      https://img-fotki.yandex.ru/get/93949/158289418.409/0_178a10_2de0f745_orig.png

      https://img-fotki.yandex.ru/get/57985/158289418.409/0_178a11_86229d94_orig.png

      https://img-fotki.yandex.ru/get/174613/158289418.409/0_178a12_3a3209b1_orig.png

      https://img-fotki.yandex.ru/get/219501/158289418.409/0_178a13_34d0dfcd_orig.png

      Полный комплект файлов: https://cloud.mail.ru/public/AUWB/urtpXx4pY

      В будущем можно будет уточнить форму 3D-моделей.

      Удлиним фрагмент:

      https://img-fotki.yandex.ru/get/196102/158289418.409/0_178a32_faabb09c_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/196102/ … 7_orig.png

      https://img-fotki.yandex.ru/get/95493/158289418.409/0_178a33_302a9b9d_orig.png

      https://img-fotki.yandex.ru/get/194588/158289418.409/0_178a34_87454028_orig.png

      https://img-fotki.yandex.ru/get/95493/158289418.409/0_178a35_d67a1a77_orig.png

      https://img-fotki.yandex.ru/get/103691/158289418.409/0_178a36_f56adba1_orig.png

      https://img-fotki.yandex.ru/get/102548/158289418.409/0_178a44_809a0fa4_orig.png

      https://img-fotki.yandex.ru/get/236239/158289418.409/0_178a45_b01f99f7_orig.png

      https://img-fotki.yandex.ru/get/236239/158289418.409/0_178a46_e1009254_orig.png

      https://img-fotki.yandex.ru/get/228174/158289418.409/0_178a47_927b6cb7_orig.png

      https://img-fotki.yandex.ru/get/228174/158289418.409/0_178a48_6b6519f5_orig.png

      Изменим композиционные углы бета- и пи-

      https://img-fotki.yandex.ru/get/195431/158289418.409/0_178a49_843bba8d_orig.png

      https://img-fotki.yandex.ru/get/218579/158289418.409/0_178a4a_37ac6ef8_orig.png

      https://img-fotki.yandex.ru/get/228104/158289418.409/0_178a4b_251d4c99_orig.png

      https://img-fotki.yandex.ru/get/196600/158289418.40a/0_178a4c_171e560f_orig.png

      https://img-fotki.yandex.ru/get/218579/158289418.40a/0_178a4d_12093ac4_orig.png

      https://img-fotki.yandex.ru/get/194549/158289418.40a/0_178a4e_e225b176_orig.png

      https://img-fotki.yandex.ru/get/196600/158289418.40a/0_178a4f_a270bba9_orig.png

      https://img-fotki.yandex.ru/get/94596/158289418.40a/0_178a50_21ae832_orig.png

      В мире белковых молекул композиционные углы сильно не меняются, но для программированной архитектуры можно сделать элементы с разными композиционными углами. В этом случае по одной и той же программе будут строиться конструкции разной формы. Это так называемая "расширенная программируемая архитектура"...




      Формы, механизмы, энергия наномира. Сообщение 87 324

      Пикотехнология белков, ДНК, РНК - 3

      Невозможная музыка белков

      https://img-fotki.yandex.ru/get/195648/158289418.40a/0_178a87_976395a5_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/196258/ … 7_orig.png

      https://img-fotki.yandex.ru/get/195648/158289418.40a/0_178a88_382ba719_orig.png

      https://img-fotki.yandex.ru/get/114207/158289418.40a/0_178a89_8565edd2_orig.png

      https://img-fotki.yandex.ru/get/194778/158289418.40a/0_178a8a_b982fa8a_orig.png

      https://img-fotki.yandex.ru/get/194588/158289418.40a/0_178a8b_6ddc5994_orig.png

      https://img-fotki.yandex.ru/get/242441/158289418.40a/0_178a8c_142492c2_orig.png

      ***
      https://img-fotki.yandex.ru/get/196600/158289418.40a/0_178a8f_728f2aa8_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/104595/ … f_orig.png

      https://img-fotki.yandex.ru/get/223280/158289418.40a/0_178a90_96b21551_orig.png

      https://img-fotki.yandex.ru/get/52446/158289418.40a/0_178a91_6b9ab686_orig.png

      https://img-fotki.yandex.ru/get/174613/158289418.40a/0_178a92_5515b54_orig.png

      ***
      https://img-fotki.yandex.ru/get/196258/158289418.40a/0_178a9a_e01f0eeb_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/94596/1 … 4_orig.png

      https://img-fotki.yandex.ru/get/169883/158289418.40a/0_178a9b_9b33950a_orig.png

      https://img-fotki.yandex.ru/get/239438/158289418.40a/0_178a9c_20cf4ea3_orig.png

      https://img-fotki.yandex.ru/get/226123/158289418.40a/0_178a9d_b5aceb39_orig.png

      https://img-fotki.yandex.ru/get/104083/158289418.40a/0_178a9e_a5cba605_orig.png

      https://img-fotki.yandex.ru/get/239438/158289418.40a/0_178a9f_290ce695_orig.png

      https://img-fotki.yandex.ru/get/227342/158289418.40a/0_178aa0_7c9888d5_orig.png

      https://img-fotki.yandex.ru/get/197807/158289418.40a/0_178aa1_74ddaea7_orig.png

      https://img-fotki.yandex.ru/get/98619/158289418.40a/0_178aa2_34e5bf23_orig.png

      ***
      https://img-fotki.yandex.ru/get/225650/158289418.40a/0_178aa4_e3e48874_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/62142/1 … 6_orig.png

      https://img-fotki.yandex.ru/get/197807/158289418.40a/0_178aa5_cdbe17d1_orig.png

      https://img-fotki.yandex.ru/get/194858/158289418.40a/0_178aa6_3e55e19c_orig.png

      https://img-fotki.yandex.ru/get/225650/158289418.40a/0_178aa7_ca8b6623_orig.png

      https://img-fotki.yandex.ru/get/177902/158289418.40a/0_178aa8_a112745c_orig.png

      ***
      https://img-fotki.yandex.ru/get/102548/158289418.40a/0_178aaa_c08c2c02_orig.png

      Развёрнуто: https://img-fotki.yandex.ru/get/196486/ … 7_orig.png

      https://img-fotki.yandex.ru/get/125649/158289418.40a/0_178aab_497914ba_orig.png

      https://img-fotki.yandex.ru/get/168237/158289418.40a/0_178aac_78c8571_orig.png

      https://img-fotki.yandex.ru/get/194835/158289418.40a/0_178aad_3d4332df_orig.png

      https://img-fotki.yandex.ru/get/177849/158289418.40a/0_178aae_c87e38bc_orig.png

      https://img-fotki.yandex.ru/get/196258/158289418.40a/0_178aaf_ee02f2d8_orig.png

      https://img-fotki.yandex.ru/get/226123/158289418.40a/0_178ab0_fc8e4ead_orig.png

      https://img-fotki.yandex.ru/get/94189/158289418.40a/0_178ab1_e2f07b5e_orig.png

      https://img-fotki.yandex.ru/get/103922/158289418.40a/0_178ab2_d6abe6fb_orig.png

      https://img-fotki.yandex.ru/get/196121/158289418.40a/0_178ab3_79821d31_orig.png

      https://img-fotki.yandex.ru/get/226123/158289418.40a/0_178ab4_f0c97eba_orig.png

      https://img-fotki.yandex.ru/get/62142/158289418.40a/0_178ab5_77ee084d_orig.png

      https://img-fotki.yandex.ru/get/196060/158289418.40a/0_178ab6_a0edbe40_orig.png


      Полный комплект файлов: https://cloud.mail.ru/public/AUWB/urtpXx4pY



      Формы, механизмы, энергия наномира. Сообщение 87 569

      Письмо Дидье Маруани / Didier Marouani от Кушелева

      Невозможная музыка белков

      https://img-fotki.yandex.ru/get/95493/158289418.410/0_1797f7_20c08997_XL.jpg

      Кушелев: Профессиональный музыкант и преподаватель взялся сделать аранжировку для музыки белков с размером 14/4: https://cloud.mail.ru/public/6KAS/wJHmX4hTK



      Говорит и показывает Пикотех - апрель 2017. Текущая погрешность модели. Уточнение композиционных углов. Сравнение алгоритмов Кушелева и Соколик.



      Проект Пикотехнология Белков Оналйн


                                                                                                                                                    

      Пикотехнология белков, ДНК, РНК. Часть 1

      Пикотехнология белков, ДНК, РНК. Часть 2   

      Пикотехнология белков, ДНК, РНК. Часть  3



      https://www.ncbi.nlm.nih.gov/protein/74 … SDMTTNU015

      https://www.ncbi.nlm.nih.gov/nuccore/743960172

      >ENA|BAQ14176|complement 2013 nucleotides

      Фрагмент:

      https://img-fotki.yandex.ru/get/235015/158289418.408/0_1789ec_3ca8357b_orig.png

      https://img-fotki.yandex.ru/get/198613/158289418.408/0_1789ed_bab1c6f4_orig.png

      https://img-fotki.yandex.ru/get/114207/158289418.408/0_1789ee_7b85f5c2_orig.png

      Изменение бета- и пи- композиционных углов существенно изменило форму модели фрагмента белка.



      https://www.ncbi.nlm.nih.gov/protein/11 … SDMTTNU015

      https://www.ncbi.nlm.nih.gov/nuccore/1145424954

      >ENA|SJN11245|4035 nucleotides

      Фрагмент:

      https://img-fotki.yandex.ru/get/218038/158289418.408/0_1789f2_e257495e_orig.png

      https://img-fotki.yandex.ru/get/102548/158289418.408/0_1789f3_66042d1b_orig.png

      https://img-fotki.yandex.ru/get/102548/158289418.408/0_1789f4_bb72d67a_orig.png

      Изменение углов бета- и пи-спиралей превратило явно неправильную форму модели в более осмысленную. К сожалению точная настройка углов - дело кропотливое даже с использованием интерактивной версии Пикотех. Так что придётся подождать до её создания...



      https://www.ncbi.nlm.nih.gov/nuccore/292397674

      https://img-fotki.yandex.ru/get/216915/158289418.407/0_178961_995b7be0_orig.png

      Развернуто: https://img-fotki.yandex.ru/get/232875/ … 6_orig.png

      https://img-fotki.yandex.ru/get/102548/158289418.407/0_178962_b6f571b3_orig.png
      Напомню, что наиболее точно показаны углы афльа- и 310-спиралей. Погрешность углов бета- и пи-спиралей может достигать 30 градусов.



      https://www.ncbi.nlm.nih.gov/nuccore/292397674

      Любопытно, что весь геном не содержит ни одного стоп-кодона, т.е. по геному можно собрать один гигантский белок.

      https://img-fotki.yandex.ru/get/218038/ … b_orig.png







      Формы, механизмы, энергия наномира. Сообщение 87 307

      Пикотехнология белков, ДНК, РНК - 3

      Продолжаем исследовать геном: https://www.ncbi.nlm.nih.gov/nuccore/292397674

      https://img-fotki.yandex.ru/get/215803/158289418.408/0_1789bc_b6f420d1_orig.png

      https://img-fotki.yandex.ru/get/41743/158289418.408/0_1789bb_d84905cd_L.png

      https://img-fotki.yandex.ru/get/215803/158289418.408/0_1789bd_349ec7fc_orig.png

      https://img-fotki.yandex.ru/get/94596/158289418.408/0_1789be_b099026e_orig.png

      https://img-fotki.yandex.ru/get/195431/158289418.408/0_1789bf_768bc4e9_orig.png

      https://img-fotki.yandex.ru/get/194492/158289418.408/0_1789c0_b5d5cb01_orig.png

      https://img-fotki.yandex.ru/get/246155/158289418.408/0_1789c1_64997b56_orig.png

      Следующий фрагмент:

      https://img-fotki.yandex.ru/get/230858/158289418.408/0_1789c3_7130a3ff_orig.png

      https://img-fotki.yandex.ru/get/215803/158289418.408/0_1789c2_4b5cf374_L.png

      https://img-fotki.yandex.ru/get/246155/158289418.408/0_1789c4_9a3df7fe_orig.png

      https://img-fotki.yandex.ru/get/25921/158289418.408/0_1789c5_ce0e1d1f_orig.png

      https://img-fotki.yandex.ru/get/104083/158289418.408/0_1789c6_30753229_orig.png

      https://img-fotki.yandex.ru/get/109878/158289418.408/0_1789c7_5ccff731_orig.png

      https://img-fotki.yandex.ru/get/172017/158289418.408/0_1789c8_6ee7e54_orig.png

      https://img-fotki.yandex.ru/get/172017/158289418.408/0_1789c9_7a5c3941_orig.png

      Следующий фрагмент:

      https://img-fotki.yandex.ru/get/54522/158289418.408/0_1789cb_be5f53fb_orig.png

      https://img-fotki.yandex.ru/get/246231/158289418.408/0_1789ca_26e315bb_L.png

      https://img-fotki.yandex.ru/get/194492/158289418.408/0_1789cc_f32b8a9d_orig.png

      https://img-fotki.yandex.ru/get/195990/158289418.408/0_1789cd_c36786fc_orig.png

      https://img-fotki.yandex.ru/get/96803/158289418.408/0_1789ce_cd5b13ea_orig.png

      https://img-fotki.yandex.ru/get/230858/158289418.408/0_1789cf_696dea71_orig.png

      https://img-fotki.yandex.ru/get/215803/158289418.408/0_1789d0_9cad4d65_orig.png

      https://img-fotki.yandex.ru/get/176331/158289418.408/0_1789d1_26f8d604_orig.png

      https://img-fotki.yandex.ru/get/215803/158289418.408/0_1789d2_5cce9287_orig.png

      "Строчка Кушелева" или "вперёд иголочкой 3D" smile

      Кстати, при дальнейшем уточнении композиционных углов может оказаться, что это своеобразная белковая структура "вязание" или "вязь".

      Мы уже встречались с белковой "вязью": http://nanoworld.org.ru/topic/1670/page/3/

      https://img-fotki.yandex.ru/get/177849/158289418.405/0_17875b_f1ed5bdb_XL.gif
      Кстати, при уточнении композиционных углов эта "вязь" может изменить топологию, т.е. петли могут захватывать не одну, а две "нити".



      Формы, механизмы, энергия наномира. Сообщение 87 309

      Письмо Дидье Маруани / Didier Marouani от Кушелева

      Пикотехнология белков, ДНК, РНК - 3

      Открыта музыка белка с размером 7/8 (Lymantria_genom)

      Размер 7/8 интересен тем, что в земной музыке не используется (пока) wink

      https://img-fotki.yandex.ru/get/246231/158289418.408/0_1789ca_26e315bb_XL.png

      https://img-fotki.yandex.ru/get/246231/158289418.408/0_1789d6_dcf8ef5e_orig.png
      Под музыку с музыкальным размером 7/8 строится переходная (спираль-вязь) белковая структура:

      https://img-fotki.yandex.ru/get/195990/158289418.408/0_1789cd_c36786fc_orig.png
      Это ещё спираль, но она уже близка к структуре "псевдовязь".

      https://img-fotki.yandex.ru/get/215803/158289418.408/0_1789d2_5cce9287_orig.png
      Это уже "псевдовязь"

      https://img-fotki.yandex.ru/get/177849/158289418.405/0_17875b_f1ed5bdb_XL.gif
      А это уже "вязь".



      Формы, механизмы, энергия наномира. Сообщение 87 254

      Пикотехнология белков, ДНК, РНК - 3

      Ищем PGAPGAPGAPGAPGAPGAPGAPGAPGAPGAPGA

      https://blast.ncbi.nlm.nih.gov

      https://www.ncbi.nlm.nih.gov/protein/11 … NZ5DF0H014

      https://www.ncbi.nlm.nih.gov/nuccore/1101224483

      OIP72816

      http://molbiol.ru/scripts/01_12.html

      >ENA|OIP72816|complement 228 nucleotides
      atgggtaatagaaacagtttaccttgcctgcctcccggtgctcccggtgctcccggtgct
      cccggtgctcccggtgctcccggtgctcccggtgctcccggtgctcccggtgctcccggc
      gctcccggtgcctcctggtgcccaatcttcccgattccccctcaaatcctttgtaggatc
      ttgttaatcctagaccagtgttggcaaattttctccacttgtttataa

      https://img-fotki.yandex.ru/get/223280/158289418.406/0_178861_4ee3666e_orig.png

      Развернуто: https://img-fotki.yandex.ru/get/218579/ … 0_orig.png

      https://img-fotki.yandex.ru/get/50936/158289418.406/0_17885c_9729af4b_orig.png

      https://img-fotki.yandex.ru/get/97884/158289418.406/0_17885d_9ea5051e_orig.png

      https://img-fotki.yandex.ru/get/50936/158289418.406/0_17885e_e5d06b40_orig.png

      https://img-fotki.yandex.ru/get/243492/158289418.406/0_17885f_539c791e_orig.png

      https://img-fotki.yandex.ru/get/226827/158289418.406/0_178860_659cff44_orig.png


      Кушелев:

      Похоже, что минимальная погрешность у модели со значением угла -30 градусов. Однако нужно учесть, что каждый композитный угол в программе реализован через три ортогональных угла. Из 6 композиционных кодов пока реализовано лишь 4. Не учитываются свойства пролина. А главное, что это геометрический алгоритм, т.е. физико-химические взаимодействия тоже не учитываются.

      Так что пока надёжным результатом программы Пикотех является только вторичная структура белка. Над третичной придётся ещё поработать. Создать интерактивную версию, настроить все композиционные углы, а в следующей версии учесть физико-химические взаимодействия. Тогда пикотехнологические 3D модел белков будут реалистичными. Пока это можно назвать условными 3D-схемами, где отчётливо видны регулярные структуры, но композиционные углы показаны приближённо. Наиболее точно настроен угол альфа-спирали. Углы бета- и пи-спирали настроены с погрешностью до 30 градусов. smile



      Формы, механизмы, энергия наномира. Сообщение 87 229

      Пикотехнология белков, ДНК, РНК - 3

      Программные белковые спирали помогают уточнить композиционные углы

      https://img-fotki.yandex.ru/get/241199/158289418.405/0_17875d_f2a6832c_orig.png
      Неточный композиционный угол пи-спирали приводит к "слипанию" витков программной спирали.

      https://img-fotki.yandex.ru/get/42618/158289418.405/0_17875e_fb9092e0_orig.png
      Варьированием композиционного угла (в скрипте приходится менять три угла, соответствующих одному композиционному коду) можно добиться правильных параметров пи-спирали и программных спиралей, содержащих композиционный код "3".

      https://img-fotki.yandex.ru/get/105284/158289418.405/0_17875c_e1e3ebe9_orig.png

      https://img-fotki.yandex.ru/get/177849/158289418.405/0_17875b_f1ed5bdb_XL.gif

      Более точную настройку композиционных углов можно будет осуществить в интерактивной 3D-версии Пикотех, которую планируется создать.



      Формы, механизмы, энергия наномира. Сообщение 87 173

      Пикотехнология белков, ДНК, РНК - 3

      https://www.ncbi.nlm.nih.gov/protein/64 … CUUFV1Y013

      https://www.ncbi.nlm.nih.gov/nuccore/641581791

      >ENA|CDO63795|14214 nucleotides

      Фрагмент:

      https://img-fotki.yandex.ru/get/217607/158289418.400/0_178553_39d36750_orig.png

      https://img-fotki.yandex.ru/get/48807/158289418.400/0_178555_68349cf2_orig.png

      https://img-fotki.yandex.ru/get/217607/158289418.400/0_178552_b3ebb67c_orig.png

      https://img-fotki.yandex.ru/get/201221/158289418.400/0_178554_22ab089d_orig.png



      Программные белковые спирали помогают уточнить композиционные углы

      Татьяна Рясина пишет:

      Алексанрд Юрьвич, Вам зачот по телепатии
      Хотела спросить, для чего вы удлиняете спирали )))))).
      Может быть Вы, ищете управляющие коды следующего уровня  через принципы  симметрии, что-то вроде языка программирования, который читается через нуклеотидную последовательность.  Слава Богу, всё яснее и проще - сложно это не хорошо )))))).

      Кушелев:

      Я сам не знал, что программные спирали помогут уточнить композиционные углы. Но так получилось...



      Посмотрим, как будет выглядеть модель программной 35-спирали (Q-спирали) при разных значениях одного из трёх компонент композиционного угла пи-спирали.

      https://img-fotki.yandex.ru/get/239438/158289418.405/0_1787f7_5b22868e_orig.png

      https://img-fotki.yandex.ru/get/251308/158289418.405/0_1787fb_da7c81c1_orig.png

      https://img-fotki.yandex.ru/get/239438/158289418.405/0_1787f6_3a7a775c_orig.png

      https://img-fotki.yandex.ru/get/242441/158289418.405/0_1787f8_ea83628b_orig.png
      Первая составляющая композиционного угла = -30 градусов.

      https://img-fotki.yandex.ru/get/102548/158289418.405/0_1787fa_6059c2bc_orig.png

      https://img-fotki.yandex.ru/get/242441/158289418.405/0_1787f9_bdf8bbc_orig.png

      https://img-fotki.yandex.ru/get/202427/158289418.405/0_1787fc_65fe6898_orig.png
      -20 градусов

      https://img-fotki.yandex.ru/get/50936/158289418.405/0_1787fd_3f3ef421_orig.png

      https://img-fotki.yandex.ru/get/239438/158289418.405/0_1787ff_ec74f186_orig.png
      -10 градусов

      https://img-fotki.yandex.ru/get/104700/158289418.405/0_178800_6eedd5a0_orig.png
      -5 градусов

      https://img-fotki.yandex.ru/get/194858/158289418.405/0_178801_89256618_orig.png

      https://img-fotki.yandex.ru/get/194835/158289418.405/0_17880a_761f2886_orig.png
      -30

      https://img-fotki.yandex.ru/get/246231/158289418.405/0_178802_acc3b5d7_orig.png
      -30

      https://img-fotki.yandex.ru/get/249782/158289418.405/0_178809_945f4a83_orig.png
      -20

      https://img-fotki.yandex.ru/get/194835/158289418.405/0_178803_7b9385e2_orig.png
      -20

      https://img-fotki.yandex.ru/get/108697/158289418.405/0_178808_b13d30dc_orig.png
      -10

      https://img-fotki.yandex.ru/get/216915/158289418.405/0_178804_9a2ba4c7_orig.png
      -10

      https://img-fotki.yandex.ru/get/143523/158289418.405/0_178807_ab063ec1_orig.png
      -5

      https://img-fotki.yandex.ru/get/244791/158289418.405/0_178806_931bf82d_orig.png
      -5

      https://img-fotki.yandex.ru/get/242441/158289418.405/0_178805_e2aa47d8_orig.png
      -5

      Осталось выбрать наиболее правильную модель. Для этого нужно узнать экспериментальные значения числа аминокислотных остатков на виток Q-спирали, радиус и шаг спирали. Возможно, что эти данные уже имеются в Protein Data Base...



      Формы, механизмы, энергия наномира. Сообщение 87 250

      Пикотехнология белков, ДНК, РНК - 3

      Программные белковые спирали помогают уточнить композиционные углы

      Продолжаем уточнять композиционные углы...

      http://subscribe.ru/archive/science.new … 2016.html/

      https://img-fotki.yandex.ru/get/246231/158289418.405/0_178802_acc3b5d7_orig.png

      https://img-fotki.yandex.ru/get/242441/158289418.405/0_178805_e2aa47d8_orig.png

      Кушелев: Здесь видно, что изменение одной из составляющих угла пи-спирали с -30 до -5 градусов меняет правую 35-спираль (Q-спираль) на левую. А это значит, что можно провести сравнительно дешёвый эксперимент с измерением вращения поляризации света в растворе, содержащим Q-спираль белка. Эксперимент поможет выяснить, является ли Q-спираль правой или левой. А вместе с этим определится и композиционный угол пи-спирали. Хотя модельный эксперимент может оказаться ещё проще и дешевле.

      http://www.nanoworld.org.ru/data/01/data/avi/bio.gif




      Пикотехнология белков, ДНК, РНК - 3

      https://www.ncbi.nlm.nih.gov/protein/59 … GY7BKE3014

      https://www.ncbi.nlm.nih.gov/nuccore/597863140

      EYC12612

      http://molbiol.ru/scripts/01_12.html

      >ENA|EYC12612|complement 978 nucleotides
      atggcgcataagaactacacaatatactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactactactactactactactactactactactactactactactac
      tactactactactactaa

      https://img-fotki.yandex.ru/get/194549/158289418.405/0_1786df_87810cd1_orig.png

      Развернуто: https://img-fotki.yandex.ru/get/57797/1 … 8_orig.png

      https://img-fotki.yandex.ru/get/25921/158289418.405/0_1786e0_966a7f3_orig.png

      https://img-fotki.yandex.ru/get/470815/158289418.405/0_1786e1_1d124a65_orig.png

      https://img-fotki.yandex.ru/get/196631/158289418.405/0_1786e2_df2cfdc9_orig.png

      https://img-fotki.yandex.ru/get/402270/158289418.405/0_1786e3_6321e951_orig.png

      Это достаточно длинный (более 300 аминокислотных остатков), но не рекордный прямой участок альфа-спирали белка, состоящий только из Tyr (остатков тирозина)

      Напомню, что рекорд для прямого участка альфа-спирали 502 аминокислотных остатка: http://subscribe.ru/archive/science.new … 0048.html/

      https://img-fotki.yandex.ru/get/196365/158289418.3ff/0_1784e9_d77a01c0_orig.png



      Формы, механизмы, энергия наномира. Сообщение 87 173

      Пикотехнология белков, ДНК, РНК - 3

      https://www.ncbi.nlm.nih.gov/protein/64 … CUUFV1Y013

      https://www.ncbi.nlm.nih.gov/nuccore/641581791

      >ENA|CDO63795|14214 nucleotides

      Удлиним фрагмент:

      https://img-fotki.yandex.ru/get/228104/158289418.400/0_178557_3b1bfac4_orig.png

      https://img-fotki.yandex.ru/get/52461/158289418.400/0_17855b_d5df9b2d_orig.png

      https://img-fotki.yandex.ru/get/196258/158289418.400/0_178556_64e20c4e_orig.png

      https://img-fotki.yandex.ru/get/194858/158289418.400/0_178558_4cfb6d65_orig.png

      Эта программная 52332233-спираль вдоль оси симметрии выглядит, как "цветик-семицветик" smile

      https://img-fotki.yandex.ru/get/52461/158289418.400/0_17855e_5a0316e1_orig.png

      https://img-fotki.yandex.ru/get/218038/158289418.400/0_17855a_c0e8de1d_orig.png

      https://img-fotki.yandex.ru/get/196258/158289418.401/0_178564_9003769e_orig.png

      https://img-fotki.yandex.ru/get/104403/158289418.401/0_178565_fb4b46d1_orig.png

      Рассмотрим второй подфрагмент и удлиним.

      https://img-fotki.yandex.ru/get/195990/158289418.401/0_178568_b38ec28b_orig.png

      https://img-fotki.yandex.ru/get/48807/158289418.401/0_17856c_85398970_orig.png

      https://img-fotki.yandex.ru/get/194503/158289418.401/0_178569_1d5d111a_orig.png

      https://img-fotki.yandex.ru/get/195990/158289418.401/0_178570_3158aa34_orig.png

      https://img-fotki.yandex.ru/get/366459/158289418.401/0_178571_ba2c38c4_orig.png

      https://img-fotki.yandex.ru/get/105020/158289418.401/0_17857c_e4d780df_orig.gif

      И ещё один фрагмент:

      https://img-fotki.yandex.ru/get/94596/158289418.401/0_178573_1ace1da6_orig.png

      https://img-fotki.yandex.ru/get/170749/158289418.401/0_178577_49931586_orig.png


      https://img-fotki.yandex.ru/get/231315/158289418.401/0_178574_49adec25_orig.png

      https://img-fotki.yandex.ru/get/114207/158289418.401/0_178576_6473b15d_orig.png

      https://img-fotki.yandex.ru/get/99813/158289418.401/0_178578_9474ae93_orig.png

      https://img-fotki.yandex.ru/get/170749/158289418.401/0_178579_ec130458_orig.png

      https://img-fotki.yandex.ru/get/226123/158289418.401/0_17857a_b0d3e989_orig.png

      https://img-fotki.yandex.ru/get/96803/158289418.401/0_17857b_f9093be0_orig.png

      В белковых спиралях ось симметрии обычно бывает дробного, иррационального, действительного порядка. При этом водородные связи могут образоваться с каждым вторым, третьим, четвертым... аминокислотным остатком.



      Формы, механизмы, энергия наномира. Сообщение 87 183

      Пикотехнология белков, ДНК, РНК - 3

      https://www.ncbi.nlm.nih.gov/nuccore/641581791


      Удлиним...

      https://img-fotki.yandex.ru/get/53993/158289418.401/0_1785d8_b5d96945_orig.png

      https://img-fotki.yandex.ru/get/108697/158289418.402/0_1785db_90802362_orig.png


      https://img-fotki.yandex.ru/get/55231/158289418.402/0_1785da_aefd87c7_orig.png

      https://img-fotki.yandex.ru/get/105020/158289418.402/0_1785d9_8168b4b_orig.png

      https://img-fotki.yandex.ru/get/25921/158289418.402/0_1785d6_e8bedd97_orig.gif


      Ещё удлиним...


      https://img-fotki.yandex.ru/get/46400/158289418.402/0_1785e1_b3714b2c_orig.png

      https://img-fotki.yandex.ru/get/53078/158289418.402/0_1785de_ea5af989_orig.png

      https://img-fotki.yandex.ru/get/108697/158289418.402/0_1785df_7a71cb36_orig.png

      https://img-fotki.yandex.ru/get/105020/158289418.402/0_1785e0_722837dd_orig.png

      https://img-fotki.yandex.ru/get/225029/158289418.402/0_1785e2_2f67004f_orig.png

      https://img-fotki.yandex.ru/get/105020/158289418.402/0_1785e3_2247a57d_orig.png

      https://img-fotki.yandex.ru/get/225029/158289418.402/0_1785e4_cf77b2dd_orig.png

      https://img-fotki.yandex.ru/get/225029/158289418.402/0_1785e5_35c2f872_orig.png

      https://img-fotki.yandex.ru/get/196161/158289418.402/0_1785e6_657310bf_orig.png

      https://img-fotki.yandex.ru/get/196161/158289418.402/0_1785e7_90f8bdec_orig.png

      https://img-fotki.yandex.ru/get/53145/158289418.402/0_1785e8_1bd0e109_orig.png

      https://img-fotki.yandex.ru/get/196161/158289418.402/0_1785e9_f8bf81e0_orig.png

      https://img-fotki.yandex.ru/get/96803/158289418.402/0_1785ea_20449840_orig.png

      https://img-fotki.yandex.ru/get/105020/158289418.402/0_1785eb_d93fb41c_orig.png

      https://img-fotki.yandex.ru/get/228104/158289418.402/0_1785ec_16e6f898_orig.png
      Один фрагмент белковой молекулы сложнее, чем "календарь" Майя smile




      Пикотехнология белков, ДНК, РНК - 3

      https://www.ncbi.nlm.nih.gov/protein/70 … CUUFV1Y013

      https://www.ncbi.nlm.nih.gov/nuccore/700200443

      >ENA|KGN58390|complement 3366 nucleotides

      https://img-fotki.yandex.ru/get/105020/158289418.401/0_178592_1df41495_orig.png


      https://img-fotki.yandex.ru/get/111568/158289418.401/0_178595_b21ee814_orig.png


      https://img-fotki.yandex.ru/get/232875/158289418.401/0_178593_9513dcee_orig.png

      https://img-fotki.yandex.ru/get/212758/158289418.401/0_178594_25ef477a_orig.png

      Фрагмент:

      https://img-fotki.yandex.ru/get/141254/158289418.401/0_178584_f27fcbd_orig.gif

      Вторичная структура полностью: https://img-fotki.yandex.ru/get/170815/ … 0_orig.gif



      Пикотехнология белков, ДНК, РНК - 3

      Кушелев: Регулярные белковые молекулы (программные спирали) помогают сравнить разные алгоритмы определения вторичной структуры:

      https://img-fotki.yandex.ru/get/61897/158289418.401/0_17857d_3145a1c1_orig.gif

      https://img-fotki.yandex.ru/get/105020/158289418.401/0_17857c_e4d780df_orig.gif

      https://img-fotki.yandex.ru/get/219501/158289418.401/0_17857e_ac49feb3_orig.gif

      https://img-fotki.yandex.ru/get/198998/158289418.401/0_178566_e89d1890_orig.png

      https://img-fotki.yandex.ru/get/141254/158289418.401/0_178584_f27fcbd_orig.gif
      Вторичная структура полностью: https://img-fotki.yandex.ru/get/170815/ … 0_orig.gif


      Рассмотрим ещё один фрагмент этого белка: https://www.ncbi.nlm.nih.gov/nuccore/641581791

      https://img-fotki.yandex.ru/get/198569/158289418.400/0_178551_85a4502d_orig.png

      Фрагмент:

      https://img-fotki.yandex.ru/get/195431/158289418.401/0_17858d_ef73e04c_orig.png

      https://img-fotki.yandex.ru/get/239438/158289418.401/0_178588_29e022_orig.png

      https://img-fotki.yandex.ru/get/366459/158289418.401/0_178589_8de3c4f7_orig.png

      https://img-fotki.yandex.ru/get/56406/158289418.401/0_17858a_2281070b_orig.png

      https://img-fotki.yandex.ru/get/104595/158289418.401/0_17858b_7ebf07b5_orig.png

      https://img-fotki.yandex.ru/get/249782/158289418.401/0_17858c_6baa98e5_orig.png

      Эта структура тоже помогает сравнить разные алгоритмы:

      https://img-fotki.yandex.ru/get/198613/158289418.401/0_17858f_4805b4d6_orig.png



      https://www.ncbi.nlm.nih.gov/protein/92 … NZ5DF0H014

      https://www.ncbi.nlm.nih.gov/nuccore/921130435

      >ENA|XP_013439753|1851 nucleotides
      atgagagcagcagcagcagcaaaggcagcaaacctggcgggcgacagggccgcgtggggc
      ccccccgcagcagcagcagcagcagcagcagcagcagcgcctgctgcgccgccagcagca
      gcaggaggcgaagtgctgcagcagctgctgtcggcggcgctgagccgcttcgagggcctc
      gccctcgagcgcatgcaaagctatgtgcagcaggagtggggcccccggcagcagcagctg
      cagcaggaagcaaataaagcagcagacttgaacttggccttattggaggccctggacttg
      gacaaactcagcacagaagacctgcaggcagttctttctttgtccgaagacatccagcgc
      caggggcccccctccgaggcagcagcagcggcccggggggccccccggggcccccggggc
      ccccgggggggggcccccacagcccgcagcagcagcagcgggggccccccagtctttgcc
      cagtcctgctgcggccggcccggccgcccgcagggcccagagggggcccccagcggcctg
      gcctcgccggggctgctggggggcccccaggggggccccctggggggcccccaggggagc
      ccgctggggggcccccaggggggccccctggggggccccctgggggcccccaacgaggaa
      ctggctggggcccccacggacttcgttgtgaccccccggggctccattagagaagcttct
      gctgccttgaggcactggagagacttgctggactatatggatgaaagagatggctttttg
      gacatgttgcggggcagcgaaagtggcagagacgtggggtgtacgtacaccccaggcggg
      cggcgggcccaggggcggcgcgcggctgcaaagggcaaagaaagaactgctgcagacaag
      gcagcgagcccccccacggggtccgcagcagcagcagcagcagcagctgctgcagcagca
      gcagcagcaggggaggcagcagcagcagaagccggcgcggggggccccacgggcgcctcc
      gcgctggctgctgctgctgctgctgctgctgctgctgctggcctcatcgactgcagcaac
      ggcaaagccagcccctcggctctcagcagcagggcctcccgccggcggtctcgccaagtg
      ctgcagaagaaagcaggaggttcgaaggacttctcgggggcccccctcgagggggtcgag
      tggcccgagggggcccccggaaagaggcactgcccggggtctccctgcagccgcttctcc
      gcattatgcgaggcttgcgagggcctcgcaagtcccccggggttggctgtggggtctgct
      gctgctgctgctgctgctgctgctgcggatgccgcgtacctgtggccgcaggggcccgag
      cgcagcagcagcagcagcagcagcagcagcagcagcagcggggcggccggcgcagcgcag
      gagggggggcccccgcccccactcgcccgcggcagcttcgcgggcaagaagggcccccgg
      ggggcccccgcgagcagcagacaaaggtgtttgtcccccttgtgtctcgacgacatgctc
      aaaatcgtctggggggcccccagggaggccgcagcccttattctcaacgacgcgcagcca
      ggggccccaggggccccaggggccccaggggccccaggggccccgggggccccgggggcc
      ccgggggccccgggggccccgggggccccgggggcttcaggggcttcaggggccccgggg
      gccccgggggcttcaggggcccctggggcccccaaagaggccctttgtgttggccggaaa
      gcggcagcgccttttggaaatgagcagtgctgctccgttaaggaggagtag

      https://img-fotki.yandex.ru/get/165720/158289418.406/0_178867_d1ff26b5_orig.png

      Развернуто: https://img-fotki.yandex.ru/get/167717/ … d_orig.png

      Фрагмент:

      https://img-fotki.yandex.ru/get/249078/158289418.406/0_178868_6ae8c6fc_orig.png
      Этот фрагмент собирается в темпе вальса. В смысле в темпе коллагена smile
      См. полный комплект файлов: https://cloud.mail.ru/public/5S1m/okiNUfhhx

      https://img-fotki.yandex.ru/get/229553/158289418.406/0_178869_786c1239_orig.png

      https://img-fotki.yandex.ru/get/225029/158289418.406/0_17886a_82ea4a62_orig.png

      https://img-fotki.yandex.ru/get/59977/158289418.406/0_17886b_cf6e7d5b_orig.png

      https://img-fotki.yandex.ru/get/230858/158289418.406/0_17886c_a323f9d6_orig.png

      https://img-fotki.yandex.ru/get/230858/158289418.406/0_17886d_749c7d93_orig.png

      Точнее всего скорее модель с величиной угла 30 градусов.




      https://www.ncbi.nlm.nih.gov/protein/11 … NZ5DF0H014

      https://www.ncbi.nlm.nih.gov/nuccore/1127494923

      >ENA|OLL84536|complement 408 nucleotides
      gtgccacccgtccagccacccgggttcagcgagttggtgcacgccccgacccggctgtcg
      ctgctgtcgctgctctcggccaccgaccggatcgagttcgggctgcttcgcgacggcctg
      gcgctgtcggactcggccttgtccaagcagctgggcatcctggaggaggccgggctggtg
      gcgttggagcgcgacggtgtggggcgcgggaagcgggtgcgtgtgcgcatgaccgacagt
      ggtcggcggaccttcgacgaccacgtcgccgcgctgcaggtcatcgtgcgccgcggcgcc
      cccggcgcccccggcgcccccggcgcccccggcgcccccggcgcccccggcgcccccggc
      gcccccggcgcccccggcgctccctcgcagtccacgtccgcgagctga

      https://img-fotki.yandex.ru/get/218038/158289418.406/0_17886f_b26ad3cc_orig.png

      Развернуто: https://img-fotki.yandex.ru/get/118251/ … 3_orig.png

      https://img-fotki.yandex.ru/get/218038/158289418.406/0_178870_cb6be9a0_orig.png

      https://img-fotki.yandex.ru/get/28561/158289418.406/0_178871_e451602c_orig.png

      Точнее, вероятно, с углом 30, но нужно уточнять дальше, причём все композиционные углы.






      Белок KR2. Оптогенетика. Лаборатория перспективных исследований мембранных белков МФТИ. Структура KR2 по Пикотехнологии Кушелева. Для авторов: Георг Бюлдт (Georg Bueldt) , Валентин Горделий, Валентин Борщевский, Вадим Черезов, Иван Гущин

      Татьяна Рясина пишет:

      По поиску    -    структура белка KR2 - находится

      https://www.google.ru/search?q=%D0%B1%D … %D0%B0+KR2

      Кушелев:

      На уровне вторичной структуры очевидно, что нет там альфа-спиралей, заявленных в PDB.



      Формы, механизмы, энергия наномира. Сообщение 83 791

      Татьяна Рясина пишет:

      Универсальный «переключатель» для светочувствительных клеток
      https://mipt.ru/newsblog/lenta/versatil … lled_cells

      "Кристаллическая структура натриевого насоса"



      Кушелев:

      Под данным РСА - сплошные альфа-спирали, а программа Пикотех показывает пи-спирали и программные спирали. Во всей структуре попался только один виток альфа-спирали и 4 одиночных витка 310-спирали smile




      https://img-fotki.yandex.ru/get/198017/158289418.3b0/0_16f268_35bc526f_XL.jpg


      Кушелев:

      Понятно. Четвертичную структуру с пятеричной симметрией разглядели, а третичную структуру заполнили альфа-спиралями, которых в этом белке нет. Надо будет построить 3D модель, когда ошибки в 3D-версии Пикотех будут исправлены.


      http://www.rcsb.org/pdb/explore/explore … ureId=4XTN

      http://www.uniprot.org/uniprot/N0DKS8

      http://www.ebi.ac.uk/ena/data/view/BAN14808

      >ENA|BAN14808|BAN14808.1 Dokdonia eikasta sodium pumping rhodopsin
      ATGACACAAGAACTAGGGAATGCCAATTTCGAAAATTTCATTGGAGCTACAGAAGGATTT
      TCTGAAATTGCTTATCAATTTACATCACATATCCTTACGTTAGGGTACGCAGTGATGCTT
      GCAGGATTACTATACTTTATCCTTACCATCAAAAATGTAGATAAAAAATTCCAAATGTCG
      AACATATTATCAGCTGTGGTAATGGTATCGGCATTTTTGCTATTATATGCGCAGGCACAA
      AACTGGACATCCAGTTTTACCTTTAATGAAGAAGTAGGAAGATATTTTTTAGATCCGAGT
      GGTGATCTATTTAATAACGGATATCGCTATCTTAACTGGCTCATCGATGTACCTATGCTT
      CTCTTTCAAATTCTATTTGTAGTAAGTTTAACTACTTCAAAATTTAGCTCTGTACGTAAC
      CAATTCTGGTTTTCTGGGGCAATGATGATTATTACTGGGTACATTGGACAGTTTTATGAG
      GTAAGTAACTTGACTGCCTTTTTAGTATGGGGAGCTATTTCATCTGCTTTTTTCTTCCAT
      ATTTTATGGGTTATGAAGAAGGTAATTAATGAAGGAAAAGAGGGGATTTCCCCAGCAGGA
      CAAAAAATACTTTCTAATATCTGGATCTTATTTTTAATATCATGGACTTTATATCCAGGA
      GCTTACTTAATGCCATACCTTACTGGAGTAGACGGATTTTTATATAGTGAAGATGGCGTG
      ATGGCTAGACAACTAGTATACACTATTGCAGATGTAAGTTCTAAAGTTATCTATGGTGTA
      TTATTAGGTAACCTAGCAATTACATTAAGTAAAAACAAAGAGTTGGTTGAAGCAAATAGC
      TAA




      Проект он-лайн сервиса "Структура белков по нуклеотидной последовательности"




      Алгоритм построения 3D структур требует уточнения композиционных углов

      Таблица митохондриального генетического кода и углы поворота белковых спиралей

      Кодируется ли тип спиралей белков композиционным генетическим кодом? Точность и стоимость РСА. Самоповерка пикотехнологии.

      Январь 2017. Кушелевские структемы генетического кода белкового мира и мультикомпозиционный код




      [20:12:40] Andrei: в чем открытие?
      [20:12:49] Andrei: комбинация кодонов?
      [20:17:14] Кушелев Александр Юрьевич: Открытие заключается в том, что три буквы кодируют не только аминокислоту, но и угол поворота этой аминокислоты относительно предыдущей:

      http://nanoworld88.narod.ru/data/216_files/bio.gif

      [20:17:59] Кушелев Александр Юрьевич: Этот угол (и формы аминокислот) как раз и открывают возможность определять структуры белков по таблице
      [20:18:08] Andrei: а что не знали что углы есть?
      [20:18:17] Кушелев Александр Юрьевич: Знали
      [20:18:23] Кушелев Александр Юрьевич: Но не знали, что эти углы кодируются




      Татьяна Рясина пишет:

      Александр Юрьевич, сделайте пожалуйста, если будет возможность структуру белка KR2 в старой версии Пикотеха - пятиконечную структуру с молекулами и вариант кольцегранной молекулы с вращением.

      Кушелев:

      Тот белок не так прост. Его в старой версии не сделать.




      Формы, механизмы, энергия наномира. Сообщение 86 978

      Пикотехнология белков, ДНК, РНК - 2

      Татьяна Рясина пишет:

      Пикотехнология тоже, как и РСА, показывает этот самый натриевый насос в белке KR2, и если да, то как?

      Кушелев:

      Для ответа на этот вопрос нужно исправить ошибки, т.е построить правильную 3D-модель этой белковой молекулы. Для этого нужна интерактивная версия программы Пикотех, которая уже запланирована, но будет создана не очень скоро. Программист сильно занят зарабатывание денег на жизнь, поэтому программами может заниматься раз в неделю по полчаса. Такими темпами можно год и больше писать интерактивную версию Пикотех-3D.



      Татьяна Рясина пишет:

      Вы могли бы сделать 3D , 4D структуру белка KR2 на обновлённой версии Пикотеха?

      Кушелев: Так новая версия ещё не готова. Программист сильно занят. Пока нашёл время только на усовершенствование 2D-версии.

      Но даже на этом уровне хорошо видно, что РСА не "видит" даже вторичную структуру белка. Поэтому исследователи заполняют её кусками альфа-спиралей "от фонаря" smile

      А реальная структура совсем другая.

      http://nanoworld.org.ru/post/81583/#p81583
      Я конечно, могу запустить определение третичной структуры на старой версии Пикотех, но может быть много ошибок. Запускать?



      Татьяна Рясина пишет:

      А самые новые апрельские структуры Вы в старой версии делаете?
      Чисто житейски лучше конечно подождать версию без ошибок.
      А потом выслать профессуре МФТИ.

      Кушелев:

      Да, пока в старой. Для спиральных участков это обычно "прокатывает", но тоже не всегда. Программные спирали бывают разные...



      Татьяна Рясина пишет:

      Но конечно хочется в старой версии увидеть тоже ))))

      Кушелев: Сейчас попробую сделать



      >ENA|BAN14808|BAN14808.1 Dokdonia eikasta sodium pumping rhodopsin
      ATGACACAAGAACTAGGGAATGCCAATTTCGAAAATTTCATTGGAGCTACAGAAGGATTT
      TCTGAAATTGCTTATCAATTTACATCACATATCCTTACGTTAGGGTACGCAGTGATGCTT
      GCAGGATTACTATACTTTATCCTTACCATCAAAAATGTAGATAAAAAATTCCAAATGTCG
      AACATATTATCAGCTGTGGTAATGGTATCGGCATTTTTGCTATTATATGCGCAGGCACAA
      AACTGGACATCCAGTTTTACCTTTAATGAAGAAGTAGGAAGATATTTTTTAGATCCGAGT
      GGTGATCTATTTAATAACGGATATCGCTATCTTAACTGGCTCATCGATGTACCTATGCTT
      CTCTTTCAAATTCTATTTGTAGTAAGTTTAACTACTTCAAAATTTAGCTCTGTACGTAAC
      CAATTCTGGTTTTCTGGGGCAATGATGATTATTACTGGGTACATTGGACAGTTTTATGAG
      GTAAGTAACTTGACTGCCTTTTTAGTATGGGGAGCTATTTCATCTGCTTTTTTCTTCCAT
      ATTTTATGGGTTATGAAGAAGGTAATTAATGAAGGAAAAGAGGGGATTTCCCCAGCAGGA
      CAAAAAATACTTTCTAATATCTGGATCTTATTTTTAATATCATGGACTTTATATCCAGGA
      GCTTACTTAATGCCATACCTTACTGGAGTAGACGGATTTTTATATAGTGAAGATGGCGTG
      ATGGCTAGACAACTAGTATACACTATTGCAGATGTAAGTTCTAAAGTTATCTATGGTGTA
      TTATTAGGTAACCTAGCAATTACATTAAGTAAAAACAAAGAGTTGGTTGAAGCAAATAGC
      TAA

      https://img-fotki.yandex.ru/get/27836/158289418.3b0/0_16f26a_f1ef536d_XL.png


      Под данным РСА - сплошные альфа-спирали, а программа Пикотех показывает пи-спирали и программные спирали. Во всей структуре попался только один виток альфа-спирали и 4 одиночных витка 310-спирали smile


      https://img-fotki.yandex.ru/get/198488/158289418.3b0/0_16f26b_484559f3_orig.gif


      https://img-fotki.yandex.ru/get/198361/158289418.3f3/0_177918_892fa641_orig.png

      https://img-fotki.yandex.ru/get/195195/158289418.3f3/0_177919_93e10d8a_orig.png

      https://img-fotki.yandex.ru/get/197756/158289418.3f3/0_177917_822c3402_orig.png





      Ключи от генома найдены

      Формы, механизмы, энергия наномира. Сообщение 86 937

      Пикотехнология белков, ДНК, РНК - 2

      Рекорды сверхдлинных спиралей белковых молекул

      Ключи от генома найдены!

      Кушелев: Мне удалось найти несколько экзотических белков в геноме Symbiodinium microadriaticum: https://www.ncbi.nlm.nih.gov/nuccore/1129213514

      Здесь можно посмотреть эти структуры: http://nanoworld.org.ru/topic/297/page/90/

      Вот одна из них:

      https://img-fotki.yandex.ru/get/30536/158289418.3f0/0_177790_20c09ef8_orig.png

      После того, как я обнаружил сразу несколько экзотических белков, у меня появилась идея загрузить в программу определения вторичной структуры весь геном: https://cloud.mail.ru/public/LmFt/zSUrH964q

      Вы видите два html-файла. Один из них - результат обработки прямой последовательности:

      https://cloud.mail.ru/public/5tS7/qkejbF2XG

      Второй - результат обработки комплементарной последовательности:

      https://cloud.mail.ru/public/4Vf8/Mh8y7bPTg

      Что же мы видим?

      https://img-fotki.yandex.ru/get/201221/158289418.3f1/0_1777b5_ba8928e9_orig.png

      ************

      https://img-fotki.yandex.ru/get/113457/158289418.3f1/0_1777b6_caceab61_orig.png

      ************

      https://img-fotki.yandex.ru/get/233608/158289418.3f1/0_1777b7_7b2f037a_orig.png

      ************

      https://img-fotki.yandex.ru/get/55918/158289418.3f1/0_1777b8_e2f152f3_orig.png

      ************

      https://img-fotki.yandex.ru/get/218579/158289418.3f1/0_1777b9_edc186f0_orig.png

      ************

      https://img-fotki.yandex.ru/get/228174/158289418.3f1/0_1777ba_17a510d_orig.png

      ************

      https://img-fotki.yandex.ru/get/251308/158289418.3f1/0_1777bb_66098eea_orig.png

      ************

      https://img-fotki.yandex.ru/get/196631/158289418.3f1/0_1777bc_eb32eacb_orig.png

      ************

      https://img-fotki.yandex.ru/get/198361/158289418.3f1/0_1777c3_1cd181cf_orig.png

      ************

      https://img-fotki.yandex.ru/get/233608/158289418.3f1/0_1777bd_75e5357a_orig.png

      ************

      https://img-fotki.yandex.ru/get/197807/158289418.3f1/0_1777be_7202389c_orig.png

      ************

      https://img-fotki.yandex.ru/get/169883/158289418.3f1/0_1777bf_f8286553_orig.png

      ************

      https://img-fotki.yandex.ru/get/61411/158289418.3f1/0_1777c4_b1dd324f_orig.png

      ************

      https://img-fotki.yandex.ru/get/236311/158289418.3f1/0_1777c0_2732c8ce_orig.png

      ************

      https://img-fotki.yandex.ru/get/194492/158289418.3f1/0_1777c1_48d29c04_orig.png

      ************

      https://img-fotki.yandex.ru/get/169883/158289418.3f1/0_1777c2_3a7d34d7_orig.png

      ************

      https://img-fotki.yandex.ru/get/194835/158289418.3f1/0_1777c5_97754561_orig.png

      ************

      https://img-fotki.yandex.ru/get/5412/158289418.3f1/0_1777c6_d0f2bf2f_orig.png

      ************

      https://img-fotki.yandex.ru/get/235015/158289418.3f1/0_1777c7_142e5726_orig.png

      ************

      https://img-fotki.yandex.ru/get/96803/158289418.3f1/0_1777c8_73208e4c_orig.png

      ************

      https://img-fotki.yandex.ru/get/169883/158289418.3f1/0_1777c9_81be2d72_orig.png

      ************

      https://img-fotki.yandex.ru/get/54787/158289418.3f1/0_1777ca_196a6962_orig.png

      ************

      https://img-fotki.yandex.ru/get/214545/158289418.3f1/0_1777cb_fd98b5d_orig.png

      ************

      https://img-fotki.yandex.ru/get/251308/158289418.3f1/0_1777cc_58fbb819_orig.png

      ************

      https://img-fotki.yandex.ru/get/218579/158289418.3f1/0_1777cd_2bca80b0_orig.png

      Комплементарная последовательность:

      https://img-fotki.yandex.ru/get/479589/158289418.3f1/0_1777fc_e0ee7e43_orig.png

      ************

      https://img-fotki.yandex.ru/get/194835/158289418.3f1/0_1777fd_f83e12d8_orig.png

      ************

      https://img-fotki.yandex.ru/get/233608/158289418.3f1/0_1777fe_7c5120e6_orig.png
      Черные поля - стоп-кодоны. Это значит, что эту часть кода нужно читать либо со сдвигом рамки считывания, либо в виде комплементарной последовательности. И ещё не нужно забывать про сплайсинг...

      https://img-fotki.yandex.ru/get/243077/158289418.3f1/0_1777ff_f80e8309_orig.png

      ************

      https://img-fotki.yandex.ru/get/197102/158289418.3f1/0_177800_8ea562c3_orig.png

      ************

      https://img-fotki.yandex.ru/get/195431/158289418.3f1/0_177801_e6c83c66_orig.png

      ************

      https://img-fotki.yandex.ru/get/51236/158289418.3f1/0_177802_ced64441_orig.png

      ************

      https://img-fotki.yandex.ru/get/196245/158289418.3f1/0_177803_12da7027_orig.png

      ************

      https://img-fotki.yandex.ru/get/198303/158289418.3f1/0_177804_da838184_orig.png

      ************

      https://img-fotki.yandex.ru/get/96803/158289418.3f1/0_177805_29749c85_orig.png

      ************

      https://img-fotki.yandex.ru/get/231315/158289418.3f1/0_177806_29c6de39_orig.png

      ************

      https://img-fotki.yandex.ru/get/246231/158289418.3f1/0_177807_17bdd93c_orig.png

      ************

      https://img-fotki.yandex.ru/get/93451/158289418.3f1/0_177808_8ed7da0e_orig.png

      ************

      https://img-fotki.yandex.ru/get/219501/158289418.3f1/0_177809_688a7dba_orig.png

      ************

      https://img-fotki.yandex.ru/get/219501/158289418.3f1/0_17780a_1b5a2e6e_orig.png

      ************

      https://img-fotki.yandex.ru/get/194835/158289418.3f1/0_17780b_1c502951_orig.png

      ************

      https://img-fotki.yandex.ru/get/237726/158289418.3f1/0_17780c_2798ae89_orig.png

      ************

      https://img-fotki.yandex.ru/get/109793/158289418.3f1/0_17780d_10308a79_orig.png

      ************

      https://img-fotki.yandex.ru/get/249782/158289418.3f1/0_17780e_5802a23e_orig.png

      ************

      https://img-fotki.yandex.ru/get/61897/158289418.3f2/0_17780f_ffdb4900_orig.png

      ************

      https://img-fotki.yandex.ru/get/467152/158289418.3f2/0_177810_8eac53a9_orig.png

      ************

      https://img-fotki.yandex.ru/get/118932/158289418.3f2/0_177811_95fe0b94_orig.png

      ************

      https://img-fotki.yandex.ru/get/197923/158289418.3f2/0_177812_a77f631_orig.png

      ************

      https://img-fotki.yandex.ru/get/244154/158289418.3f2/0_177813_c0aeb5e4_orig.png

      ************

      https://img-fotki.yandex.ru/get/479589/158289418.3f2/0_177814_e03a79eb_orig.png

      ************

      https://img-fotki.yandex.ru/get/194835/158289418.3f2/0_177815_89b79ce7_orig.png

      ************

      https://img-fotki.yandex.ru/get/106693/158289418.3f2/0_177816_a85c2282_orig.png

      ************

      https://img-fotki.yandex.ru/get/93500/158289418.3f2/0_177817_9439787f_orig.png

      ************

      https://img-fotki.yandex.ru/get/108697/158289418.3f2/0_177818_cd7acc05_orig.png

      ************

      https://img-fotki.yandex.ru/get/93500/158289418.3f2/0_177819_4a7b55c9_orig.png

      ************

      https://img-fotki.yandex.ru/get/251308/158289418.3f2/0_17781a_a3a926bd_orig.png

      ************

      https://img-fotki.yandex.ru/get/60881/158289418.3f2/0_17781b_cc5cb77d_orig.png

      ************

      https://img-fotki.yandex.ru/get/94893/158289418.3f2/0_17781c_65b122b0_orig.png

      ************

      https://img-fotki.yandex.ru/get/51057/158289418.3f2/0_17781d_fa7b562b_orig.png

      ************

      https://img-fotki.yandex.ru/get/195771/158289418.3f2/0_17781e_fbbd9a88_orig.png

      ************

      https://img-fotki.yandex.ru/get/246231/158289418.3f2/0_17781f_d7dabbbd_orig.png

      ************

      https://img-fotki.yandex.ru/get/251308/158289418.3f2/0_177820_ea28f706_orig.png

      ************

      https://img-fotki.yandex.ru/get/246231/158289418.3f2/0_177821_308c1e49_orig.png

      ************

      https://img-fotki.yandex.ru/get/25921/158289418.3f2/0_177822_4f6a4aeb_orig.png

      ************

      https://img-fotki.yandex.ru/get/239438/158289418.3f2/0_177823_4848bef2_orig.png

      Это и есть ключи от генома!

      Достаточно набрать поиск по характерной последовательности, и команда "найти" в браузере покажет Вам CDS с интересующим Вас кодом белка. Конечно, не все ключи соответствуют белкам, но существенная часть соответствует. Это видно невооружённым взглядом smile

      Более того, если Вы не нашли по ключу белок в данном геноме, то у Вас есть много шансов найти его в базе данных EMBL, например, с помощью системы BLAST: https://blast.ncbi.nlm.nih.gov


      https://img-fotki.yandex.ru/get/117474/158289418.3f0/0_17778e_4dbd3238_orig.png

      https://img-fotki.yandex.ru/get/244154/ … a_orig.png

      https://img-fotki.yandex.ru/get/366459/158289418.3f0/0_17778c_e35d62d4_orig.gif


      Формы, механизмы, энергия наномира. Сообщение 86 952

      Пикотехнология белков, ДНК, РНК - 2

      Обнаружены белки-изоморфы!

      https://img-fotki.yandex.ru/get/198303/158289418.3f2/0_177913_c1ba6822_orig.png

      Кушелев: Сдвиг рамки считывания не влияет на структуру этого белка! Белок сохраняет как первичную аминокислотную последовательность, так и вторичную структуру. Но кое-что всё-таки меняется. Сдвигаются варианты композиции относительно аминокислотной последовательности.
      Нет, не сдвигаются! Вот это - номер...

      https://img-fotki.yandex.ru/get/164839/158289418.3f2/0_177915_5c268ea7_orig.png
      Структура белка, построенного по комплементарной последовательности, обладает тем же свойством!



      Формы, механизмы, энергия наномира. Сообщение 86 963

      Пикотехнология белков, ДНК, РНК - 2

      Разгадана тайна невероятной информационной ёмкости генома

      https://www.ncbi.nlm.nih.gov/nuccore/1129213514#

      Кушелев: Участок генома Symbiodinium microadriaticum, соответствующий бета-спирали длиной 200 аминокислотных остатков.

      >ENA|genom_green|
      GCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGCAGCA
      GCAGCAGCAGCGGCAGCAAAAGCAGTAGCATTAGCAGTAGCAGTAGCAGTAGCAGGAGCA
      GGAGCAGGAGCAGGAGCAGGAGCAGGAGCAGTAGGAGCAGCAGCAGCAGCAGCAACAGCA
      GCACAGCAGGAGAAGTAG

      https://img-fotki.yandex.ru/get/25921/158289418.3f3/0_17791c_b2750c19_orig.png

      https://img-fotki.yandex.ru/get/194492/158289418.3f3/0_17791b_84ee62e2_orig.png

      Если сдвинуть рамку считывания

      на 1 позицию . . . на 2 позиции . . . на 1(complement) . . . на 2(complement)

      https://img-fotki.yandex.ru/get/226827/158289418.3f3/0_17791e_ef1babb5_XL.png . https://img-fotki.yandex.ru/get/194869/158289418.3f3/0_17791f_c6be9238_XL.pnghttps://img-fotki.yandex.ru/get/98619/158289418.3f3/0_177920_8d5cc2f0_XL.png . . https://img-fotki.yandex.ru/get/196365/158289418.3f3/0_177921_6a9325b2_XL.png

      Сдвиг рамки считывания приводит к длинным альфа-спиралям, пи-спирали и 14-спирали.

      Кстати, в данном геноме эта часть последовательности используется для формирования длинной альфа-спирали EQEQEQ: https://img-fotki.yandex.ru/get/226827/ … 5_orig.png

      Достаточно иметь в геноме один такой участок, чтобы строить альфа-, пи- и бета-спирали длиной от 1 до 200 аминокислотных остатков. Ведь достаточно задать лишь начальное положение рамки считывания, а стоп-кодоны остановят создание спирали нужной длины. Вот где находится разгадка тайны невероятной информационной ёмкости генома!



      Формы, механизмы, энергия наномира. Сообщение 86 936

      Пикотехнология белков, ДНК, РНК - 2

      Рекорды сверхдлинных спиралей белковых молекул

      http://nanoworld.org.ru/topic/297/page/90/
      https://img-fotki.yandex.ru/get/231315/158289418.3f0/0_1776ae_c82bd0eb_orig.png
      https://img-fotki.yandex.ru/get/94893/1 … b_orig.png

      Альфа-спираль длиной 737-322+1=416 аминокислотных остатков

      https://img-fotki.yandex.ru/get/233608/158289418.3f1/0_1777a1_8b0680a7_orig.png
      https://img-fotki.yandex.ru/get/95629/1 … a_orig.png

      310-спираль длиной 308-46+1=263 аминокислотных остатка

      http://nanoworld.org.ru/topic/297/page/85/
      https://img-fotki.yandex.ru/get/152444/158289418.3e9/0_177249_643719e9_orig.png
      https://img-fotki.yandex.ru/get/93500/1 … 5_orig.png

      Пи-спираль длиной 206-140+1=67 аминокислотных остатков

      http://nanoworld.org.ru/topic/297/page/79/
      https://img-fotki.yandex.ru/get/244791/ … 6_orig.png

      Бета-спираль длиной  аминокислотных остатка 132-89+1=44 аминокислотных остатка

      http://nanoworld.org.ru/topic/297/page/84/
      https://img-fotki.yandex.ru/get/166616/158289418.3e9/0_1771f4_f4ffddbe_orig.png
      https://img-fotki.yandex.ru/get/196245/ … d_orig.png

      323322-спираль длиной 1000-927+1=74 аминокислотных остатка

      https://img-fotki.yandex.ru/get/94189/1 … 7_orig.png

      123-спираль длиной 1570-1540+1=31 аминокислотных остатков

      http://nanoworld.org.ru/topic/297/page/81/
      https://img-fotki.yandex.ru/get/243369/158289418.3e6/0_176ebf_4ec313ac_orig.png
      https://img-fotki.yandex.ru/get/169608/ … 6_orig.png

      114-спираль длиной 92-21+1=72 аминокислотных остатка

      https://img-fotki.yandex.ru/get/117896/158289418.3e6/0_176ec1_caf790d3_orig.png
      https://img-fotki.yandex.ru/get/243369/ … c_orig.png

      144-спираль длиной 73-2+1=72  аминокислотных остатка

      http://nanoworld.org.ru/topic/297/page/79/
      https://img-fotki.yandex.ru/get/94189/1 … d_orig.png

      12-спираль длиной 47-8+1=40 аминокислотных остатков

      https://img-fotki.yandex.ru/get/243369/ … c_orig.png

      23-спираль длиной 53-25+1=29 аминокислотных остатков

      http://nanoworld.org.ru/topic/297/page/79/
      https://img-fotki.yandex.ru/get/112407/ … 8_orig.png

      35-спираль длиной 230-52+1=179 аминокислотных остатков

      http://nanoworld.org.ru/topic/1610/page/94/
      https://img-fotki.yandex.ru/get/111359/158289418.3f0/0_177797_8ee1686a_orig.png
      https://img-fotki.yandex.ru/get/46400/1 … 8_orig.png

      1444-спираль длиной 239-65+1=175 аминокислотных остатков

      http://nanoworld.org.ru/post/82802/#p82802
      https://img-fotki.yandex.ru/get/196070/ … 5_orig.png

      Метиониновая спираль длиной 183-154+1=31 аминокислотных остатков





      Асферические контактные линзы со светозащитным покрытием, 16 век.



      Асферические контактные линзы со светозащитным покрытием 16 век



      Формы, механизмы, энергия наномира. Сообщение 86 775

      Асферические контактные линзы со светозащитным покрытием 16 век.

      FaceBook

      https://img-fotki.yandex.ru/get/43388/158289418.34d/0_15ef46_f1c1ea99_XL.jpg

      Елена Бореева: Этот монстр стережёт на дне?

      Александр Кушелев: Нет. Это череп человека, который при жизни(!) был облицован минеральными плитками (бирюза и обсидиан), а в глазницы были вставлены алмазные контактные линзы со светозащитным покрытием (вероятно, несколько атомных слоёв золота). Хранится он около 100 лет в Британском музее, а известен с 16 века (его получил Кортес, предводитель испанцев от Монтесумы).

      Такая технология пломбирования черепа позволяет находиться в морской воде неограниченное время и выдерживать перегрузки в десятки раз больше современных космонавтов. Инопланетяне использовали людей в качестве пилотов своих "летающих тарелок", как во время Второй мировой войны люди использовали собак, которые бросались под танки со связками гранат.

      Елена Бореева: Вы сами догадались про тарелки и пилотов?

      Александр Кушелев: Двигатель "летающей тарелки" (Microwave Engine, Emdrive) я испытал ещё в далёком 1992-ом году. В 2014-ом аналогичный двигатель испытали в NASA, а в 2016-ом китайцы испытали его уже на околоземной орбите.

      Александр Кушелев: А про то, что Тескатлипока был пилотом "летающей тарелки" я догадался по перегрузке, которую может выдержать череп, если заменить стекловидное тело глаз на алмаз, вклееный в глазницы.

      Елена Бореева: А чей двигатель, кто его сконструировал?

      Александр Кушелев: Крестодвигатель (резонатор рыбьей волны) я сделал по образу церковных крестов, т.к. предположил, что кресты церквей изображают электромагнитные двигатели звездолетов

      Александр Кушелев: Подробнее о Тескатлипоке: http://nanoworld.org.ru/topic/1089/

      Александр Кушелев: Подробнее о двигателях "летающих тарелок": http://nanoworld88.narod.ru/data/404.htm

      Александр Кушелев: Подробнее об эфире, внутренняя энергия которого поможет обходиться без традиционного топлива и летать на браслетах и "тарелках": http://www.nanoworld.org.ru/data/05/20021205/index.htm



      Как устроен кибернетический глаз-алмаз Тескатлипоки?

      Подробнее: http://nanoworld.org.ru/topic/1089/page/16/

      https://img-fotki.yandex.ru/get/43388/158289418.34d/0_15ef55_d0b45d0_XL.jpg

      Кушелев: Первый эксперимент в Британском музее показал, что я недооценил инопланетян. Глаз-алмаз Тескатлипока оказался сложнее, чем я думал раньше. Тут нужно учесть, что я дилетант в оптике, поэтому от меня ускользнули некоторые нюансы устройства кибернетического глаза.

      В оптических устройствах (фотоаппаратах, видеокамерах, телескопах...) некоторые внутренние поверхности имеют чёрный цвет. При этом конструкторы добиваются минимизации бликов. Следуя этой логике часть поверхности глаза-алмаза должна быть чёрной и небликующей. При этом с внешней стороны может казаться, что весь глаз-алмаз имеет одинаковую поверхность, похожую на поверхность железного колчедана (пирита, золота дураков).

      Давайте посмотрим, как должна быть покрыта алмазная/бриллиантовая линза Тескатлипока с точки зрения современной оптики. Спереди свет должен быть ослаблен светозащитным покрытием, чтобы не перегружать сетчатку, т.к. площадь линзы больше площади зрачка. Давайте сразу уточним этот коэффициент.

      https://img-fotki.yandex.ru/get/100269/158289418.356/0_160e26_a0a8f81c_orig.gif
      Подробнее: https://ru.wikipedia.org/wiki/Зрачок

      Максимальный диаметр зрачка человека 8 мм, а диаметр алмазной линзы 24 мм, т.е. в 3 раза больше. Следовательно площадь алмазной линзы в 3^2=9 раз больше. Значит светозащитное покрытие должно пропустить не больше 1/9=11% светового потока. Если же глаз-алмаз рассчитан на дополнительные усилители светового потока, что делает его более защищённым, то коэффициент пропускания покрытия может быть значительно меньше 11%. В таком случае при идеальном отражении от внутренней поверхности назад может выйти лазерный луч, ослабленный в 9^2=81 раз. Если же внутренняя поверхность черная, то ослабление в 81 раз нужно ещё умножить на коэффициент отражения от чёрной поверхности. Для сажи этот коэффициент примерно равен 2%.

      https://img-fotki.yandex.ru/get/56520/158289418.356/0_160e31_3000274c_XL.png
      Современные химические светопоглощающие покрытия имеют примерно те же параметры, что и сажа, т.е. интегральный коэффициент отражения в видимом диапазоне порядка 2%, но уже сегодня существуют нанотехнологические покрытия, у которых интегральный коэффициент отражения на порядок меньше. Понятно, что у инопланетян этот коэффициент может быть ещё меньше. Но даже если он равен 0.2%, как у современного нано-покрытия, то общий коэффициент отражения получится (1/81)*0.2%=0.0025% Понятно, что заметить отраженный луч лазера от такого покрытия - непростая техническая задача.

      А теперь давайте посмотрим, как конкретно может быть покрыта алмазная линза с точки зрения современной оптики. Какие участки должны быть полупрозрачными, какие поглощающими, какие максимально прозрачными.

      https://img-fotki.yandex.ru/get/142729/158289418.356/0_160e32_7f795d00_XL.jpg
      Если бы зона сетчатки была полностью прозрачной, то исследователи, которые вынимали глаз, заметили бы, что это не пирит. Раз этого не случилось, то скорее всего внешнее покрытие одинаково со всех сторон. Это логично с точки зрения упрощения технологии. Достаточно увеличить коэффициент пропускания с 11% до 33%, и не нужно заморачиваться с зоной сетчатки. При этом коэффициент ослабления будет тот же, в 9 раз, а коэффициент отражения будет 0.2%/9 = 0.022% (чуть больше, чем 2 сотых процента). Всё-равно отражённый луч ослаблен в 5000 раз, поэтому заметить его проблематично. Исключение составляет лишь случай, если луч лазера точно попадёт в зону сетчатки и частично отразившись выйдет через переднюю поверхность. Минимальное ослабление будет в том случае, если угол падения максимальный, т.е. луч должен войти у края линзы и выйти у противоположного края. В этом случае он будет ослаблен в 9 раз светозащитным покрытием и коэффициентом внутреннего отражения. Расчёт поможет определить максимально возможный коэффициент внутреннего отражения и соответственно общий коэффициент ослабления лазерного луча.



      Асферические контактные линзы (просветленная оптика) 16 век.

      Skype, 2016-08-26:

      [12.08.2016 14:58:35] Кушелев Александр Юрьевич: И в Вашем случае гораздо легче один раз дойти до музея с лазерной указкой и видеокамерой, чем большего года писать в скайпе, что Вам всё это неинтересно. smile
      [26.06.2016 20:06:15] Кушелев Александр Юрьевич: Привет, Томас! Поздравляю! Ваш поезд ушёл: http://nanoworld.org.ru/topic/1089/page/16/
      [20:06:41] Tomas R.: ну наконец-то
      [20:06:47] Кушелев Александр Юрьевич: Вас опередила 14-летняя девочка, которая приехала из России в Лондон
      [20:07:12] Tomas R.: big_smile
      [20:07:33] Tomas R.: Саня, прикольный вы...
      [20:07:52] Кушелев Александр Юрьевич: Но у Вас ещё есть шанс стать вторым...
      [20:08:03] Кушелев Александр Юрьевич: Хотя для этого придётся достать тепловизор...
      [20:08:21] Tomas R.: во. что сейчас придумали big_smile ?
      [20:08:43] Кушелев Александр Юрьевич: Krooto с форума лаборатории Наномир придумал, как надёжно установить, алмаз или не алмаз.
      [20:09:10] Кушелев Александр Юрьевич: Достаточно нагревать глаза 1-2 ваттным лазером и записывать картинку на тепловизор.
      [20:09:35] Кушелев Александр Юрьевич: У алмаза самая высокая теплопроводность, поэтому таким способом его легко отличить от всех других материалов.
      [20:09:35] Tomas R.: давай, Наташа smile
      [20:10:04] Кушелев Александр Юрьевич: У Вас под носом эксперименты проводят школьники из России.
      [20:10:16] Кушелев Александр Юрьевич: Зовут её Маша smile
      [20:10:25] Кушелев Александр Юрьевич: "Сам ты Наташа" wink
      [20:11:53] Кушелев Александр Юрьевич: Эксперимент N2 будет проведён с тепловизором. Но это будет скорее всего последний "поезд" smile
      [20:16:11] Tomas R.: "Варвары из России уничтожили уникальный экспонат древнего мира туземцев Америки. Главный подстрекатель - торговец дорогими камнями - Кушелев Александр Юрьевич"
      [20:17:19] Tomas R.: Им влепят штраф, в лучшем случаи, а о вас узнает весь Мир big_smile Гениально... деньги потекут рекой
      [20:19:43] Кушелев Александр Юрьевич: Мы скоро начнём делать монокристаллические видеокамеры для мобильников из китайского синтетического алмаза: http://nanoworld.org.ru/topic/1280/
      [20:21:54] Tomas R.: Алмазы это хорошо... они дорогие...
      [20:22:20] Tomas R.: а где алмазы, там Кушалев...
      [20:22:35] Кушелев Александр Юрьевич: 2 доллара стоит синтетический алмаз для монокристаллической камеры, если заказывать 1000 штук в Китае.
      [20:25:19] Tomas R.:  Статья 159 Уголовного кодекса РФ. Мошенничество
      [20:25:33] Tomas R.: Мошенничество, совершенное организованной группой либо в особо крупном размере, -
      наказывается лишением свободы на срок до десяти лет со штрафом в размере до одного миллиона рублей или в размере заработной платы или иного дохода осужденного за период до трех лет либо без такового.
      [20:26:41] Кушелев Александр Юрьевич: Вы упускаете последний шанс войти в историю развития науки и техники. Самая крупная научная сенсация за всю историю человеческой культуры уже пошла мимо Вас smile
      [20:27:21] Кушелев Александр Юрьевич: Школьница из России утёрла Вам нос tongue
      [20:28:42] Кушелев Александр Юрьевич: Вы смотрели фильм "Назад, в будущее!" ?
      [20:28:53] Кушелев Александр Юрьевич: "История скоро изменится..."
      [20:29:14] Tomas R.: ну да... зима близится...
      [20:30:01] Кушелев Александр Юрьевич: Вы протянули целый год. За это время до Британского музея уже школьница из России добралась.
      [20:34:21] Tomas R.: Кушелев, вы мошенник... низко пали
      [20:35:53] Кушелев Александр Юрьевич: Это Вы - трус. smile
      [20:36:20] Кушелев Александр Юрьевич: А работники музея лентяи
      [20:36:36] Кушелев Александр Юрьевич: Я им писал, что готов заплатить за эксперимент с лазерной указкой.
      [20:37:32] Кушелев Александр Юрьевич: А они ответили, что готовы только копии старых фоток продать. Тех, которые уже на Яндексе выложены smile
      [20:42:38] Tomas R.: для начала докажите кому-то свою уникальность.
      [20:44:14] Кушелев Александр Юрьевич: А кто по-Вашему открыл композиционный генетический код? Кстати, слыхали новость?

      https://img-fotki.yandex.ru/get/103691/158289418.355/0_160218_38606b31_XL.jpg

      [20:44:25] Кушелев Александр Юрьевич: Издана книга "Пикотехнология белков" smile
      [20:46:55] Tomas R.: полный интернет таких всяких книг
      [20:47:10] Кушелев Александр Юрьевич: Подробнее: http://nanoworld.org.ru/post/76284/#p76284
      [20:47:33] Кушелев Александр Юрьевич: Там показан в работе композиционный генетический код.



      3D структуры март-апрель 2017. Проект он-лайн сервиса структур белков по нуклеотидной последовательности



      Проект Пикотехнология Белков Оналйн


                                                                                                                                                    

      Пикотехнология белков, ДНК, РНК. Часть 1

      Пикотехнология белков, ДНК, РНК. Часть 2   

      Пикотехнология белков, ДНК, РНК. Часть  3




      Кодируется ли тип спиралей белков композиционным генетическим кодом?

      Точность и стоимость РСА (рентгено-структурного анализа).

      Самоповерка пикотехнологии.



      Формы, механизмы, энергия наномира. Сообщение 86 504

      Пикотехнология белков, ДНК, РНК - 2

      Skype:

      [22.03.2017 18:49:44] Кушелев Александр Юрьевич: А список меню постепенно растёт...
      1. 2D-структура в новом формате.
      2. Файл в стандарте MIDI
      3. Компактный файл fasta (с отработанными Join и Complement)
      4. Компактный файл dne/embl (только идентификатор белка и входной код. С простым CDS 1..n)
      5. 2D-структура в старом формате (как сейчас) с разбивкой по 1000 строк. 
      6. Композиционный код-6
      7. Композиционный код-4

       Также в меню добавляется  компактная запись вторичной структуры белка

       Раскрашивание триплетов по алгоритму вторичной структуры экономит время.


      Код-6 получается из кода 4 по дополнительному простому алгоритму. Но проблема заключается в том, что в программе-скрипте, которую написал Денис Савин, зарезервировано меньше вариантов композиций, чем нужно для реализации кода-6

      А доделывать эту Версию Валентин считает неправильным. Он хочет сделать правильную версию на другом языке. Ждём-С



      Формы, механизмы, энергия наномира. Сообщение 86 878

      Пикотехнология белков, ДНК, РНК - 2

      Татьяна Рясина пишет:

      Как кратко пояснить, зачем нужен сайт с готовыми моделями? Люди вообще слышат и видят в первый раз в жизни.

      Кушелев:

      Ежедневно на нашей планете кто-то оплачивает не менее 30 заказов по структурам белковых молекул. Это видно по увеличению количества белков в Protein Data Base (PDB). За каждую структуру платят в среднем 10 000 евро и ждут от нескольких недель до нескольких лет.

      Структуры нужны фармацевтам, биотехнологам, генным инженерам. Потенциальных заказчиков можно найти по ключевым словам protein, nanotech



      https://img-fotki.yandex.ru/get/30536/158289418.3f0/0_177790_20c09ef8_orig.png

      https://img-fotki.yandex.ru/get/61164/158289418.3f0/0_177791_b040673f_orig.png

      https://img-fotki.yandex.ru/get/102548/158289418.3f0/0_177792_945c6af6_orig.png

      https://img-fotki.yandex.ru/get/102548/158289418.3f0/0_177793_f54bab17_orig.png

      https://img-fotki.yandex.ru/get/199051/158289418.3f0/0_177794_94fd2306_orig.png

      https://img-fotki.yandex.ru/get/404236/158289418.3f0/0_177795_6961e838_XL.png


      Развёрнуто: https://img-fotki.yandex.ru/get/205820/ … a_orig.png



      Формы, механизмы, энергия наномира. Сообщение 87 086

      Пикотехнология белков, ДНК, РНК - 2

      Открыта программная трехлопастная 323321321-белковая спираль

      Кушелев: А теперь давайте посмотрим, не найдутся ли комплементарные ноты Лунной сонаты?

      Вместо n(QNT) нужно найти n(TNQ)

      https://blast.ncbi.nlm.nih.gov

      Итак, ищем TNQTNQTNQTNQTNQTNQTNQTNQTNQTNQTNQTNQTNQ

      https://www.ncbi.nlm.nih.gov/protein/56 … TJUM2XZ016

      https://www.ncbi.nlm.nih.gov/nuccore/564280748


      Вообще-то это не комплементарное преобразование, а фрактальный реверс, но ... тоже интересно!


      Разметка триплетов

      https://img-fotki.yandex.ru/get/174613/158289418.3f6/0_177d89_50965d5e_orig.png


      Вид вдоль оси симметрии. Примерно 8.5 аминокислотных остатков на виток.

      https://img-fotki.yandex.ru/get/233608/158289418.3f6/0_177d44_5e7845ae_orig.pnghttps://img-fotki.yandex.ru/get/225029/158289418.3f6/0_177d42_a8059090_orig.png
      https://img-fotki.yandex.ru/get/198361/158289418.3f6/0_177d43_f74d2081_orig.png
      Так выглядит 233-спираль (7 витков, 60 аминокислотных остатков)

      Это, как и 35-спираль (Q-спираль) может быть пикотехнологическим реактором. Только меньшего диаметра (раза в полтора) и соответственно большего давления (раза в два).

      https://img-fotki.yandex.ru/get/233044/158289418.3f6/0_177d40_51982051_orig.gif

      Программная 233-спираль переходит в очень необычную трёхлопостную программную спираль.

      https://img-fotki.yandex.ru/get/218579/158289418.3f6/0_177d3d_69bf9721_orig.png


      Циклическое повторение 30 аминокислотных остатков соответствует такой структуре.

      https://img-fotki.yandex.ru/get/225029/158289418.3f6/0_177d3f_1aafb705_orig.png
      Циклическое повторение 30 аминокислотных остатков соответствует такой структуре.


      https://img-fotki.yandex.ru/get/196142/158289418.3f6/0_177d8c_c3724a62_orig.pnghttps://img-fotki.yandex.ru/get/194858/158289418.3f6/0_177d8d_76b47271_orig.png 

      "Красота форм в природе" smile      Атомы изображены шариками


      https://img-fotki.yandex.ru/get/244154/158289418.3f6/0_177d8e_f39bd714_orig.pnghttps://img-fotki.yandex.ru/get/93917/158289418.3f6/0_177d92_deea5300_orig.png
      Межатомные связи изображены трубками.  Электронные оболочки изображены точками


      https://img-fotki.yandex.ru/get/195648/158289418.3f6/0_177d93_f3f55237_orig.pnghttps://img-fotki.yandex.ru/get/99813/158289418.3f6/0_177d94_30f83753_orig.png

      https://img-fotki.yandex.ru/get/366459/158289418.3f7/0_177d97_99223f91_orig.png

      https://img-fotki.yandex.ru/get/171919/158289418.3f7/0_177d9a_b05e6f03_orig.pnghttps://img-fotki.yandex.ru/get/362774/158289418.3f7/0_177d9c_fdd9128c_orig.pnghttps://img-fotki.yandex.ru/get/196161/158289418.3f7/0_177d9f_dd6ee792_orig.pnghttps://img-fotki.yandex.ru/get/225029/158289418.3f7/0_177d9e_8804aa3b_orig.png

      https://img-fotki.yandex.ru/get/196548/158289418.3f7/0_177da1_be116ab9_orig.pnghttps://img-fotki.yandex.ru/get/171919/158289418.3f7/0_177da2_c91be39a_orig.png
      Такая необычная трехлопастная программная спираль встречается в белковых молекулах...




      Формы, механизмы, энергия наномира. Сообщение 87 115

      Пикотехнология белков, ДНК, РНК - 2

      https://img-fotki.yandex.ru/get/108697/158289418.3f9/0_177f3f_687e9332_L.png

      IN(L,D)NINNINNV

      https://blast.ncbi.nlm.nih.gov

      http://molbiol.ru/scripts/01_12.html

      https://www.ncbi.nlm.nih.gov/protein/11 … ZFCTC45013

      https://www.ncbi.nlm.nih.gov/nuccore/1103666979

      CRG93487


      https://img-fotki.yandex.ru/get/468374/158289418.3fa/0_178033_caa68dc6_orig.png

      https://img-fotki.yandex.ru/get/218579/158289418.3fa/0_178038_98f318c7_orig.png

      https://img-fotki.yandex.ru/get/196060/158289418.3fa/0_178039_10f1ca8c_orig.png

      https://img-fotki.yandex.ru/get/172931/158289418.3fa/0_17803b_1ffa431a_orig.png

      https://img-fotki.yandex.ru/get/57422/158289418.3fa/0_17803c_9aeaeb47_orig.png

      https://img-fotki.yandex.ru/get/218579/158289418.3fa/0_17803d_d5713dbd_orig.png

      https://img-fotki.yandex.ru/get/55431/158289418.3fa/0_17803e_5ce019c8_orig.png

      По нотам 40-ой симфонии Моцарта нашлась ... треугольная спираль!

      Однако музыку Моцарта, которая звучит при сборке этого белка мы пока не услышим. Белок слишком крупный для того, чтобы программа могла обработать его целиком. Нужно найти этот фрагмент.

      https://img-fotki.yandex.ru/get/148218/158289418.3fa/0_1780c2_58d06d8a_orig.png

      https://img-fotki.yandex.ru/get/246155/158289418.3fa/0_1780c7_b14477fe_orig.png

      https://img-fotki.yandex.ru/get/217607/158289418.3fa/0_1780c8_313af073_orig.png

      https://img-fotki.yandex.ru/get/198786/158289418.3fa/0_1780c9_539ecb2e_orig.png

      https://img-fotki.yandex.ru/get/26144/158289418.3fb/0_17810c_70babda3_orig.png
      Музыка сборки этого фрагмента (10 нот) совпадают с началом 40-ой симфонии Моцарта.





      Формы, механизмы, энергия наномира. Сообщение 87 117

      Пикотехнология белков, ДНК, РНК - 2

      https://www.ncbi.nlm.nih.gov/protein/12 … TJUM2XZ016

      https://www.ncbi.nlm.nih.gov/nuccore/124805469

      >ENA|XP_001350449| 3270 nucleotides

      https://img-fotki.yandex.ru/get/227342/158289418.3fa/0_178025_a5db014f_orig.png

      https://img-fotki.yandex.ru/get/233608/158289418.3fa/0_178029_bb3834dd_orig.png
      Похоже, что дисульфидный мостик Cys17-Cys28 должен замкнуться.

      https://img-fotki.yandex.ru/get/195786/158289418.3fa/0_17802a_9a14ccf4_orig.png

      https://img-fotki.yandex.ru/get/216915/158289418.3fa/0_17802b_df05631f_orig.png

      https://img-fotki.yandex.ru/get/249782/158289418.3fa/0_17802e_df8a2971_orig.png
      Напластование "восьмёрок", как в белке EWC87459, и цикл, который через них замыкается.




      https://www.ncbi.nlm.nih.gov/protein/25 … TJUM2XZ016

      https://www.ncbi.nlm.nih.gov/nuccore/258596982

      >ENA|XP_001347352|1152 nucleotides

      https://img-fotki.yandex.ru/get/246231/158289418.3f7/0_177e25_ca37a4c1_orig.png

      https://img-fotki.yandex.ru/get/171919/158289418.3f7/0_177e27_a0edf363_orig.gif

      Конец белковой молекулы соединяется с началом фрагмента через дисульфидный мостик.

      https://img-fotki.yandex.ru/get/107473/158289418.3f7/0_177e2a_7994a7b_orig.png

      https://img-fotki.yandex.ru/get/194835/158289418.3f7/0_177e2b_26a32b4_orig.png

      https://img-fotki.yandex.ru/get/107473/158289418.3f7/0_177e2c_5c323044_orig.png

      https://img-fotki.yandex.ru/get/195990/158289418.3f7/0_177e2f_c3c1829a_orig.png

      Конечно, за 7 десятков композиций накапливается ошибка, ведь алгоритм не учитывает физико-химические взаимодействия. Тем не менее очевидно, что речь идёт о циклическом фрагменте из 72 (семидесяти двух!) аминокислотных остатков.

      https://img-fotki.yandex.ru/get/235925/158289418.3f7/0_177e32_dcf53bb5_orig.png

      https://img-fotki.yandex.ru/get/195195/158289418.3f7/0_177e33_41568203_orig.png

      https://img-fotki.yandex.ru/get/54787/158289418.3f7/0_177e34_b6bb70ef_orig.png

      https://img-fotki.yandex.ru/get/94189/158289418.3f7/0_177e36_cd91f47_orig.png

      https://img-fotki.yandex.ru/get/177849/158289418.3f7/0_177e37_f1f28629_orig.png

      Этот фрагмент состоит из элементов программной трёхлопастной спирали.

      Подробнее: http://nanoworld.org.ru/topic/297/page/98/




      Формы, механизмы, энергия наномира. Сообщение 87 116

      Пикотехнология белков, ДНК, РНК - 2

      https://www.ncbi.nlm.nih.gov/protein/64 … ZFCTC45013

      https://www.ncbi.nlm.nih.gov/nuccore/641579244

      >ENA|CDO66378|11550 nucleotides

      https://img-fotki.yandex.ru/get/120725/158289418.3fb/0_1780f5_fcf4d7ca_orig.png

      https://img-fotki.yandex.ru/get/96803/158289418.3fb/0_1780f6_9795c966_orig.png

      https://img-fotki.yandex.ru/get/51236/158289418.3fb/0_1780f8_ad4191a7_orig.png

      https://img-fotki.yandex.ru/get/206909/158289418.3fb/0_1780f9_4b26f3a2_orig.png

      https://img-fotki.yandex.ru/get/31027/158289418.3fb/0_1780fa_8cd04305_orig.png

      https://img-fotki.yandex.ru/get/196183/158289418.3fb/0_1780fb_b70c94f3_orig.png

      https://img-fotki.yandex.ru/get/225029/158289418.3fb/0_1780fe_c417534a_orig.png

      https://img-fotki.yandex.ru/get/53078/158289418.3fb/0_1780ff_d127a054_orig.png

      https://img-fotki.yandex.ru/get/174613/158289418.3fb/0_178102_d48532e4_orig.png

      https://img-fotki.yandex.ru/get/198017/158289418.3fb/0_178103_3fa66df7_orig.png

      https://img-fotki.yandex.ru/get/174613/158289418.3fb/0_178107_b88b0472_orig.png

      https://img-fotki.yandex.ru/get/104700/158289418.3fb/0_178108_9d57caad_orig.png

      https://img-fotki.yandex.ru/get/6712/158289418.3fb/0_178109_2c0e67bb_orig.png

      https://img-fotki.yandex.ru/get/225650/158289418.3fb/0_17810a_73c7fc65_orig.png

      https://img-fotki.yandex.ru/get/99813/158289418.3fb/0_17810b_e8292a39_orig.png
      Музыка сборки этого фрагмента белковой молекулы




      Пикотехнология белков, ДНК, РНК - 2

      https://www.ncbi.nlm.nih.gov/protein/59 … PG4YMDD013

      https://www.ncbi.nlm.nih.gov/nuccore/597849141

      Кушелев: Забавная программная 34443555-спираль. Интересно будет посмотреть 3D модель...

      https://img-fotki.yandex.ru/get/196102/158289418.3f6/0_177cef_7471db00_orig.png

      https://img-fotki.yandex.ru/get/197741/158289418.3f6/0_177cec_9dc62a4_orig.png

      https://img-fotki.yandex.ru/get/113457/158289418.3f6/0_177ced_9fd71fde_orig.png

      https://img-fotki.yandex.ru/get/216915/158289418.3f6/0_177cee_3d73bd_orig.png

      https://img-fotki.yandex.ru/get/229651/158289418.3f6/0_177cf2_725b4fcc_orig.png

      https://img-fotki.yandex.ru/get/249479/158289418.3f6/0_177cf3_fbbcaac3_orig.png
      К сожалению, код "5" в существующей 3D-версии Пикотех ещё отрабатывается не корректно. Поэтому мы пока не узнаем реальную форму программной 34443555-спирали. Фактически мы видим форму 3111-спирали. Она имеет ось симметрии 7-го порядка.

      https://img-fotki.yandex.ru/get/224193/158289418.3f6/0_177cf4_2385bf4_orig.png

      https://img-fotki.yandex.ru/get/195132/158289418.3f6/0_177cf6_393ad529_orig.png

      https://img-fotki.yandex.ru/get/195518/158289418.3f6/0_177cf7_2de2700d_orig.png

      https://img-fotki.yandex.ru/get/247911/158289418.3f6/0_177cf8_53cfeb03_orig.png

      Корректная отработка кода "5" должна привести к деформации 34443555-спирали. Но это мы сможем увидеть в будущем, когда будет доделана следующая версия программы Пикотех-3D.



      Формы, механизмы, энергия наномира. Сообщение 87 104

      Пикотехнология белков, ДНК, РНК - 2

      https://www.ncbi.nlm.nih.gov/protein/91 … TJUM2XZ016

      https://www.ncbi.nlm.nih.gov/nuccore/226466085

      https://img-fotki.yandex.ru/get/227342/158289418.3f9/0_177f0d_5e81eb9e_orig.png

      https://img-fotki.yandex.ru/get/61164/158289418.3f9/0_177f0e_427088f6_orig.png
      Понятно, что треугольник из пи-спиралей должен замкнуться.

      https://img-fotki.yandex.ru/get/94189/158289418.3f9/0_177f10_2efd002b_orig.png
      В модели он почти замкнут. Это понятно, ведь алгоритм чисто геометрический. Не учитывает физико-химические взаимодействия.

      https://img-fotki.yandex.ru/get/237815/158289418.3f9/0_177f11_63f432ba_orig.png
      Углы пи-спирали, вероятно, настроены неточно.

      https://img-fotki.yandex.ru/get/197756/158289418.3f9/0_177f12_cbdabc4d_orig.png
      Как уже было замечено ранее, самое сложное в моделировании - переходы с одного типа спирали на другую.

      https://img-fotki.yandex.ru/get/228174/158289418.3f9/0_177f13_2ae5259b_orig.png
      Именно в области перехода с одной спирали на другую погрешности углов сказываются сильнее всего. Тем не менее, накопившаяся за 70 аминокислотных остатков ошибка порядка 10 диаметров атома углерода. Это значит, что в пересчёте на один аминокислотный остаток погрешность не превышает 10/70=13% от размера атома.

      https://img-fotki.yandex.ru/get/229553/158289418.3f9/0_177f35_16a600b8_orig.gif



      https://www.ncbi.nlm.nih.gov/protein/58 … TJUM2XZ016

      https://www.ncbi.nlm.nih.gov/nuccore/508695481

      https://img-fotki.yandex.ru/get/197756/158289418.3fa/0_177f4e_78889396_orig.gif

      https://img-fotki.yandex.ru/get/30752/158289418.3f9/0_177f52_5e510a54_orig.png

      https://img-fotki.yandex.ru/get/249078/158289418.3f9/0_177f53_2260bf9d_orig.png

      https://img-fotki.yandex.ru/get/114758/158289418.3f9/0_177f55_f273cbf5_orig.png


      https://img-fotki.yandex.ru/get/233608/158289418.3fa/0_177f58_af320d6_orig.png

      https://img-fotki.yandex.ru/get/194835/158289418.3fa/0_177f59_3c347406_orig.png

      https://img-fotki.yandex.ru/get/194835/158289418.3fa/0_177f5c_b5939706_orig.png

      https://img-fotki.yandex.ru/get/242441/158289418.3fa/0_177f5d_11934a22_orig.png



      Формы, механизмы, энергия наномира. Сообщение 87 120

      Пикотехнология белков, ДНК, РНК - 2

      Белковая спираль Моцарта-Кушелева


      https://img-fotki.yandex.ru/get/25939/158289418.3fc/0_178174_314dcbb0_orig.png

      IDDIDDIDDV

      https://www.ncbi.nlm.nih.gov/protein/25 … ZJ2D64R013

      https://www.ncbi.nlm.nih.gov/nuccore/255722494



      https://img-fotki.yandex.ru/get/197741/158289418.3fb/0_178163_2a74bcaa_orig.png



      https://img-fotki.yandex.ru/get/48807/158289418.3fb/0_178166_150beb15_orig.png

      https://img-fotki.yandex.ru/get/42692/158289418.3fb/0_178167_9b250c9f_orig.png

      https://img-fotki.yandex.ru/get/169451/158289418.3fb/0_178168_3b1d40fb_orig.png

      https://img-fotki.yandex.ru/get/194588/158289418.3fb/0_178169_7b0e1347_orig.png

      https://img-fotki.yandex.ru/get/196121/158289418.3fb/0_17816a_c2980d29_orig.png

      https://img-fotki.yandex.ru/get/196365/158289418.3fb/0_17816b_be2c5015_orig.png

      https://img-fotki.yandex.ru/get/42692/158289418.3fb/0_17816c_74555147_orig.png

      https://img-fotki.yandex.ru/get/55195/158289418.3fc/0_17816d_c353bddb_orig.png

      https://img-fotki.yandex.ru/get/231315/158289418.3fc/0_17816e_c436c3fc_orig.png

      https://img-fotki.yandex.ru/get/56796/158289418.3fc/0_17816f_ecb4dce5_orig.png

      https://img-fotki.yandex.ru/get/231315/158289418.3fc/0_178171_9dc735f8_orig.png
      Спираль Моцарта-Кушелева (533-спираль) интересна тем, что на один виток приходится почти 14 аминокислотных остатков. При этом спираль имеет ось симметрии ~5 порядка.

      Любопытно и то, что композиционный код сдвинут относительно музыкального (и первичной последовательности), т.е. разным нотам соответствует одинаковая композиция соседних аминокислотных остатков и в то же время разные углы поворота соответствуют одинаковым нотам. Более того, третья нота, как и в 40-ой симфонии Моцарта звучит вдвое дольше второй!

      https://img-fotki.yandex.ru/get/479589/158289418.3fc/0_178175_12f1e36b_orig.png
      Это связано с тем, что вторая нота соответствует коду альфа-спирали, когда нет вращения транспортной РНК, а третья нота соответствует коду пи-спирали, когда тратится время на дополнительное вращение тРНК.



      Формы, механизмы, энергия наномира. Сообщение 86 835

      Пикотехнология белков, ДНК, РНК - 2

      Онлайн сервис "Структура белка по нуклеотидной последовательности"

      Кушелев: Здравствуйте, уважаемые коллеги!
      Предлагаю расширить Ваш сервис, дополнив его демонстрацией вторичной структуры белка по нуклеотидной последовательности и другими .  Подробности: http://nanoworld.org.ru/topic/1653/

      С уважением,
      Руководитель лаборатории Наномир,
      Александр Кушелев



      https://img-fotki.yandex.ru/get/194588/158289418.3eb/0_1773f0_a0e02a4f_orig.png

      https://img-fotki.yandex.ru/get/176508/158289418.3eb/0_1773f3_9993c661_orig.png

      https://img-fotki.yandex.ru/get/195786/158289418.3eb/0_1773f4_cc38541_orig.png




      https://img-fotki.yandex.ru/get/198488/158289418.3eb/0_1773fe_3c0cb47a_orig.png

      https://img-fotki.yandex.ru/get/196142/158289418.3eb/0_1773ff_bfe32618_orig.png




      https://img-fotki.yandex.ru/get/107080/158289418.3ea/0_1772e0_35f2af04_orig.png

      https://img-fotki.yandex.ru/get/42692/158289418.3ea/0_1772e1_1154d43_orig.png


      Пикотехнологические реакторы с внутренними и внешними конвейерами

      https://img-fotki.yandex.ru/get/152444/158289418.3e9/0_17720a_f2f0d072_orig.png

      https://img-fotki.yandex.ru/get/51236/158289418.3e9/0_17720b_846e943a_orig.png



      https://img-fotki.yandex.ru/get/176331/158289418.3ea/0_1772f1_ca84f3cf_XL.png

      https://img-fotki.yandex.ru/get/174613/158289418.3eb/0_177307_5190645a_orig.gif

      https://img-fotki.yandex.ru/get/228104/158289418.3eb/0_177353_87f3465b_orig.gif

      https://img-fotki.yandex.ru/get/143523/158289418.3ed/0_177457_97fe24e1_orig.png

      https://img-fotki.yandex.ru/get/168237/158289418.3ed/0_177458_3b4dadbf_orig.png

      https://img-fotki.yandex.ru/get/166616/158289418.3ed/0_177459_6898e8d2_orig.png


      https://img-fotki.yandex.ru/get/195431/158289418.3ed/0_177452_9698d0d6_orig.gif


      https://img-fotki.yandex.ru/get/94596/158289418.3ed/0_17744e_a1bc987d_orig.png

      https://img-fotki.yandex.ru/get/218579/158289418.3ed/0_17744f_ade38994_orig.png

      https://img-fotki.yandex.ru/get/196258/158289418.3ed/0_177451_c2e23eca_orig.png

      https://img-fotki.yandex.ru/get/114207/158289418.3ed/0_17744d_37ee9227_orig.gif

      Структура белка определена правильно

      https://img-fotki.yandex.ru/get/94596/158289418.3ef/0_177648_87e9f9a2_orig.png
      Равнобедренный пятиугольник!

      https://img-fotki.yandex.ru/get/366459/158289418.3ef/0_177649_bba16b25_orig.png

      https://img-fotki.yandex.ru/get/225029/158289418.3ef/0_17764a_e2690627_orig.png


      https://img-fotki.yandex.ru/get/54787/158289418.3ef/0_177645_5727d316_orig.gif



      https://img-fotki.yandex.ru/get/173114/158289418.3ef/0_17768b_821d013d_orig.png

      https://img-fotki.yandex.ru/get/104083/158289418.3ef/0_177666_c92d708e_orig.gif

      https://img-fotki.yandex.ru/get/237726/158289418.3ef/0_177669_da5b48d9_orig.gif



      Длина прямого альфа-спирального участка достигает 737-322+1=416 аминокислотных остатков. Вероятность случайного кода = 4^-415=10^-250

      https://img-fotki.yandex.ru/get/54522/158289418.3f0/0_1776af_40b8f715_orig.png

      https://img-fotki.yandex.ru/get/199051/158289418.3f0/0_1776b3_701396fa_orig.png


      https://img-fotki.yandex.ru/get/197923/158289418.3ef/0_17769f_f1c221a_orig.png

      https://img-fotki.yandex.ru/get/197923/158289418.3ef/0_1776a0_5e52def9_orig.png

      https://img-fotki.yandex.ru/get/195990/158289418.3ef/0_1776a1_5c9f6229_orig.png

      https://img-fotki.yandex.ru/get/106693/158289418.3ef/0_1776a2_2baefa49_orig.png


      Каждая "загогулина" NQQFQV является мета-элементом пико-конструктора.

      В отличие от аминокислот мета-элементы складываются в параллелепипеды, т.е. программирование идёт как бы на уровне кубиков с прямыми углами. Хотя ... может показалось, что углы прямые.

      https://img-fotki.yandex.ru/get/243369/158289418.3e6/0_176ec8_a6567e_XL.png

      https://img-fotki.yandex.ru/get/59613/158289418.3e6/0_176ecb_597bbb1e_XL.png


      https://img-fotki.yandex.ru/get/244791/158289418.3e3/0_176b54_7b8ee6c7_XL.png

      https://img-fotki.yandex.ru/get/93500/158289418.3e3/0_176b55_4f0dcfaf_XL.png



      Q-спираль по существу является реактором, состоящим из атомов азота...

      https://img-fotki.yandex.ru/get/226123/158289418.3e4/0_176d07_db0043b_XL.png

      https://img-fotki.yandex.ru/get/30536/158289418.3e4/0_176d06_aae8cb52_orig.gif


      https://img-fotki.yandex.ru/get/196365/158289418.3e4/0_176d08_a81c1ffb_XL.png


      https://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d09_d60bc7c5_XL.png

      https://img-fotki.yandex.ru/get/169883/158289418.3e4/0_176d0a_12fe5ea6_XL.png

      https://img-fotki.yandex.ru/get/57797/158289418.3e4/0_176d0c_8a39a920_XL.png


      https://img-fotki.yandex.ru/get/196183/158289418.3e4/0_176d0f_119a0535_XL.png

      https://img-fotki.yandex.ru/get/52790/158289418.3e4/0_176d0b_1e8c03ad_XL.png

      https://img-fotki.yandex.ru/get/30894/158289418.3e4/0_176d10_7aef9c77_XL.png

      https://img-fotki.yandex.ru/get/246231/158289418.3e4/0_176d11_685d4236_XL.png



      https://img-fotki.yandex.ru/get/109878/158289418.3e4/0_176dc1_ef9cfd1d_XL.png

      https://img-fotki.yandex.ru/get/9116/158289418.3e4/0_176dc2_ba7df904_XL.png

      https://img-fotki.yandex.ru/get/197807/158289418.3e4/0_176dc3_a58ff018_XL.png

      https://img-fotki.yandex.ru/get/105284/158289418.3e4/0_176dc4_b6415408_XL.png

      https://img-fotki.yandex.ru/get/48807/158289418.3e5/0_176dc5_395b486d_XL.png

      https://img-fotki.yandex.ru/get/9116/158289418.3e5/0_176dc6_6b0b4f76_XL.png



      https://img-fotki.yandex.ru/get/52127/158289418.3e3/0_176a8c_f8137db4_orig.gif

      https://img-fotki.yandex.ru/get/197807/158289418.3e3/0_176a8d_7fce694f_XL.png

      https://img-fotki.yandex.ru/get/55828/158289418.3e3/0_176a8e_a93244e3_XL.png

      https://img-fotki.yandex.ru/get/194778/158289418.3e3/0_176a8f_ea1b182_XL.png

      https://img-fotki.yandex.ru/get/197756/158289418.3e3/0_176a90_e00cc5d2_XL.png

      https://img-fotki.yandex.ru/get/62701/158289418.3e3/0_176a91_926d0146_XL.png

      https://img-fotki.yandex.ru/get/176331/158289418.3e3/0_176a92_8770b630_XL.png

      https://img-fotki.yandex.ru/get/177902/158289418.3e3/0_176a93_10824faf_XL.png

      https://img-fotki.yandex.ru/get/94596/158289418.3e3/0_176a94_78259010_XL.png

      https://img-fotki.yandex.ru/get/226827/158289418.3e3/0_176a95_3d306123_XL.png